HYN
Happy New year to all Bemuddled fans and observers... I'm of to demolish 1.5 bottles of very low quality Champagne LOL!
2004... it's gotta rool.

Merry Christmas
To all the avid Bemuddlement readers out there.. and there a few... I'm off to swallow a whole can of Anchor Rum flavoured squirty cream.

Words of Wisdom
"Only go places you've been before..... and in dayight"

Things Learned this Week
a) Eurostar Coaches 1 and 18 have no seats numbered 1-17
b) That the huge mound of flowers at Port-Royal RER station was for the victims of a terrorist attack at that station on 03-DEC-1996
c) I don't actually care if Modular Technologies ever update their PCI DAB card software, now I have discovered "DAB Bar"

Things I Learnt Today
Oliver Heaviside (British Physicist 1850-1925), discoverer of the Heaviside layer, had a sofa permanently on the stairs. In attempting to move it from downstairs to upstairs, the sofa got stuck. Refusing to ask for help, the sofa remained in situ. This was relayed to me by his great great great niece of Oliver himself.

Thing Learnt Today
The origin of the saying "Fred Karno's Army". A quaint expression I never heard before. Not to be confused with Karnaugh Maps, which having spent 3 years of college life manually drawing out the damned things and then 2 months of my college life (all those years ago) writing a rather excellent program in Pascal to generate said maps, I was then relieved to discover there is now a freeware software option available.

Little Defeat
Tasty pack of Wheat Crunchies (Crispy Bacon Flavour) 30p; Inserted £1; returned 40p; Net Loss 10p

Little Victory
Tasty cup of campachino 18p; Inserted 20p; returned 4p; net profit 2p

Grime Watch
"HOW AM I DRIVING? CALL 0800-IAMCRAP". White truck M25 clockwise.

Life in the Slow Lane: "....back and to the left" A record 3 accidents passed on the journey in today. Most spectacular was the small non-de script hatchback that was shunted off the motorway, across the hard shoulder, through a dividing picket fence and then sitting proud on a small grassy knoll (no assassin was spotted). Two large continental juggernauts seem to be involved. The "Lone Juggernaut" theory doesn't hold water, when inspecting the damage to the vehicle. It was clear that the majority of damage came from IN FRONT of the driver and a second vehicle must have been involved to create the damage to the side and rear. This is, of course, you support the "Magic Juggernaut" theory, which would involve one impact to the rear at 68mph, a 67 degree swerve forwards to the right and the a 14 degree glancing impact travelling left and finally a 180 degree turn at 127mph to hit the hatchback head on. Journey Duration: 1.75 plays of Rickie Lee Jones "The Evening of My Favorite Day" [****1/4]

Rickie Lee Jones provides not only her finiest album for 18 years (IMHO) but todays journey time metrication technique

Little Victory
Campachino 18p; Inserted 20p; returned 22p; net profit 20p

'tis the season to be grimeful
The good thing about winter is that car/van/truck graffiti grime is very high. Damp conditions, invariably throw dirty, muck laden spray onto the vehicle and the air of joviality apparent during the festive season, often results in some transit monkey scribing a 'witty' message on the side of their (or usually someone else's) mode of transport. If one were to equate this to a mathematic equation:-

f(x) = p * (whn/20160)

Where
x = The probability of Grime graffiti on the back of a van/truck
w = Number of wet hours in the preceding 5 days
h = Number of hours vehicle is left standing stationary amongst ones work colleagues in the last 24 hours
p = Popularity Factor of driver amongst colleagues (Bemuddlement has noticed that most grime graffiti is clearly not authored by the driver as most is self derogatory). On a scale of 0..1 [based on the Watkins Scale of Popularity]
n = Copies of Tabloid newspapers read in the last 7 days by scribe

Hence the addition of the inscription of "OSSA" along side the letter "T" in "COURT" should've been predicted.

The Scientist in Me
No that isn't a reference to a particularly intellectual homo-erotic practice, just I couldn't resist washing the hands in aforementioned washroom and experimenting which dryer would actually dry a hand quicker
a) Dryer #1: The fast blowing arctic temperature blower
b) Dryer #2: The pathetic puffer of warm air

Result... initially Dryer #1 was seem to dry the (left) hand faster than Dryer #2. On leaving the washroom, it seemed both had been equally unsuccessful and that Dryer #1's perceived success was due to the numbness induced by the -20deg c wind chill factor.

Odd look from fellow patron as I stood there with one hand under each dryer... nothing was said.

Cool Breeze
Well the washroom dryer drama continues. A few weeks ago (see Breezes post 25 Nov 2003) did the long awaited replacement for dryer #2 arrived. Today, dryer #1's heater element has failed, resulting in deliverance of cool icy blast to the hands, thus making it as ineffective as the pathetic warm air puffer that is dryer #2. Wet door handle time again.

Tracks Guaranteed to Make me Reach for Lilo
Comfortably Numb - Pink Floyd

Life in the Slow (Country) Lane
Just for a change I thought I would take the sedate route into work and travel through the country lanes of this great nation. OK, so the M25 was closed between J6 and J7, causing major South East chaos... not for this boy though... we know every back alley route to Gatwick known to Christian Man (and a few atheistic ones too). A few observations
- There is a far better class of 'school run' in Tonbridge, judging by the number 911's, Series 5's and C-Classes cluttering the suburbs of this largest Kentish town
- Cheapest Xmas Trees were at a farm just past the Mormon church in Lingfield (£1 a foot)
- Funniest name of village Award: Dunk's Hill

Recommended Way to Spend 15 Minutes 36 Seconds
Awaken - Yes.

Illegal Tyre Grime
"SEBLING QUALITY TYRES" it says on the back of a VIKING yellow transit M25 approaching J6. Some wag scrawled "NOT" with an insertion glyph between the "SEBLING" and the "QUALITY". Amazed that
a) Anyone would actually bother to do that
b) That such a person would know how to represent textual insertion

Life in the Slow Lane
Big hellos to the driver of a silver 206 and 4x4, who very nearly made my morning by almost colliding 30ft in front of me coming unto the M20 this morning.
Now I can't use the mobile phone (see Dec 01 post), I juggled with half a dozen CDs, jewel cases and CD wallet instead. This mornings playlist included:-

Come - Fleetwood Mac (best guitar solo of 2003)
Shot by a Bullet - UFO (The greatest unsung band of all time)
Most of the Time - Bob Dylan
Devil Inside - INXS (surprised myself by timing the "HA HA HA" perfectly)
Romeo & Juliet - Dire Straits (on Radio)
There's No Home for you Here - White Stripes (longest sustained note of 2003)
September Morn - Neil Diamond
Shoot High, Aim Low - Yes
Chop Suey - System of a Down
Dumpweed - Blink 182

In fact it was pretty Dylanesque at times with bits of "Tangled Up In Blue" and "Shooting Stars".

Life in the Slow Lane
"SLOW DOWN. SPRAY" was the message on the overhead gantry on the M20. Plenty of oppourtunity to read the message, at the sedate speed fo 20mph.

"The Future's Bright, The Future's...."

From today it will be illegal to operate a mobile phone whilst driving in the UK. However like all things in the UK, the vagueness of this particular law is comical in the extreme. For example, depending on who you watch/listen to this morning, the following facts could be gleaned, that whilst driving:

a) It's OK to operate a mobile phone if you have a hands free kit
b) It's not OK to operate a mobile phone with hands free, unless it's in a cradle
c) It's OK to operate your mobile phone with an earpiece, if you Blu-tac the phone to the dashboard
d) It's not OK to operate the phone if you actually have to hold the phone (earpiece or not)
e) It's OK to operate your mobile phone, if all you have to do is prod at the keys of the phone.
f) Some Police Forces in the UK are operating an "only warning" policy for 2 months, not issuing fines to offending motorists
g) Some Police Forces in the UK are issuing fines as of today
h) Driving whilst using a mobile phone is hazardous and a huge problem. Large numbers of people are killed each year by motorists using mobile phones whilst driving.
i) It's OK to use an earpiece on your mobile phone, for answering calls.
j) It's not OK to use an earpiece on your mobile, to make a call (unless you only prod the keys)
k) Using a mobile phone whilst driving is as dangerous as lighting a cigarette
l) There are laws already covering lighting a cigarette whilst driving.
m) Mobile phones are bad.
n) Mobile phones are good
o) Using a mobile phone whilst driving, with a bluetooth earpiece is OK.
p) Using a mobile phone whilst driving, is not OK if your parked with the engine on.

Confused? It's simple... just another excuse to squeeze more money out of the motorists and provide insurance companies with another reason NOT to pay up in the event of an accident. If road safety really is an issue in this country, then maybe a more prudent measure would be to limit the size, weight and numbers of juggernauts using the motorways during the hours of daylight (and especially during rush-hour). I'm sure the poor unfortunate soul who used to own a Black Peugeot 306 (N reg) that was obliterated, on the hard shoulder of the M25 (J5-2-J6) this morning, would agree.

"Breezes"
After months of inactivity, the 2nd hand blower dryer, in the upstairs workplace toilets, has been replaced. Unfortunately it's much more "Doldrums" than "Roaring Forties". This results in a lottery for the users of the facilities on exit. The point at which you grab the handle on the door to exit the facilities (usually with one finger) is crucial, so as to avoid further wetness transfer. One likes to think it is just water, but the "Cocktail Peanut Bowl" urban legend is never far from thought.

Life in the Slow Lane
"Just In Time" is a supply concept. In the good old days, stores used to keep ample supplies of stock so, for example, if you desired a radiator cap for a 1974 Ford Granada Ghia 2.8, chances were you could trot along to your local spares shop of your choice and purchased said item. However, keeping stock and judging what peiople would like to buy is expensive, so that is why when you wish to purchase, say, a bottom hose for a 2001 Peugeot 307 GLX 1.6L, you will be greated with the reply "It will be in tommorrow". What does this mean for the casual reader of this column? Why am I 'banging on' about this? Well at this time of year, i.e. approaching xmas, consumer demand is high and there is only one way which your stock of artificial 5ft xmas trees is going to be transported from huge warehouse in Milton Keynes, to the distribution depot just off the M3....thats right.. hefty big juggernauts. Multiply this by say... 10,000 and it goes someway to explaining why it now takes 15 mins to get onto the M20 at J6 Westbound t 7am in the morning and another 20mins to queue onto the M26.
Journey Time: 1.3 plays of "I Am Sam" soundtrack CD.

Obscene Grime Squad
"HONK IF YOU SMELL OF WEE!" inscribed on the back of a medium sized white removal type truck, on the northern summit approach of the A229.

Life in the Slow Lane
Grime graffiti has been low to non-existent of late, although "Also available in Grey" was spotted on the back of a grey transit van, exiting off J10 of the M23.
However today there were 24 Chimney Pots spotted on the back of a pick-up, going clockwise around the M25 between J5a (aka Clackett Lane) and J6. Journey was slow, but at least gave me chance to play "Abbey Road" all the way through and "Golden Slumbers/Carry that Weight/In The End" at least three times... made me smile.

Little Victory
2 x 1p found on floor by coffee machine; Net profit 2p.

Collected Gains
Small change "Smash" tin cashed in; Sum Total 44.92UKP

Current Spin(s) aka "A Stuart McConie Moment" Tales of a Librarian - Tori Amos : Tori's children given a new lease of life. Whilst not going the full Bon Jovi route in completely revamping her 'Hits' package (re: "This left Feels Right") these songs have been lovingly  remixed, re-mastered and  re-recorded, to the extent that it's an essential purchase for the  Toriphiles. With  some new tunes thrown in  and a bonus DVD edition for the die-hard completists (if you bought all 5 "Strange Little Girls" you'll get both the 'standard' and 'limited edition' versions), ToaL could be the "Collection CD" of the season. If only all retrospective releases were as good as this.

Tori Amos... simply stunning

Little Defeat
Campachino (still) 18p; Inserted 50p; returned 27p; Net Loss 5p.

Things I learned This Week
a) This is the funniest thing I've seen in years
b) Milton Keynes is a lot further than you think
c) Reading isn't that much nearer
d) That Wortip Crispy Chicken tastes as good as I remembered (recovering vegetarian news)
e) ... as did the Spare Ribs


Current Spins
Rush - In Rio : AWESOME as you would expect
REM - In Time : Best of thingy, with limited edition B-sides : Good Rarities collection
Robert Plant - Sixty Six to Timbuktu : Made me realise that RP solo career has actually been quite good... no "Burning Down One Side" or "Pledge Pin" though
Bon Jovi - This Left feels Right (Limited Edition with DVD) : Just for "Wanted Dead or Alive"
Paul Oakenfold - Great Wall : Heard the Bjork "Pagan Poetry" re-mix in HMV... had to purchase
Limp Bizkit - Results may Vary : Great album, despite losing Wes... however "Behind Blue Eyes" is unforgivable
Bob Dylan - The Essential Bob Dylan : Nice stop gap until I have the lot. No "Most of the Time" which really is essential.

Things we learned this week
a) How to spell "traceability"
b) The Vauxhaul Vectra 2.2 SRi is a great car with illogical indicator control
c) Manchester on 5th November is like the Somme

Life in the Slow Lane Car fire, southbound M23: Time Delay 5 tracks off Paul Oakenfields "The Great Wall"
	Come home to a real fire, on the hard shoulder of the M23.. this morning

Tempting Little Victory
29p left on top of letter in external post tray (no I didn't).

Life in the Slow Lane
The sadness of Rover 75 drivers has often been observed by this blog, but this morning the sadness reached new depths. Spotted on the Kent/Surrey section of the M25 a Rover 75 rear number plate, correctly designed so as to fit the "Jaguar" style space on the tailgate.. BUT with a rectangular personalised plate STUCK on it... shame on you Mark.

Life in the Slow Lane
Rather spectacular crash M23 Northbound, leaving a car on the hard shoulder SOUTHBOUND (either than or the back end was swiped by a rubber necker). Time Delay: 2 plays of a "Radiohead" song.

Little Victory
Campachino 18p; Inserted 20p; Returned 6p; Net profit 4p; Running Week Total Profit 19p

Little Victory 2
Tasty Cup of Campachino Coffee 18p; Inserted 20p; Returned 7p; Net profit 5p.

Current Spins
Yes - Going for the One (Expanded and Remastered); "High Vibration Go On"
Limp Bizkit - Results May Vary; "@#*&% ^£@~~!"

Little Victory
Tasty Cup of Campachino Coffee 18p; Inserted 20p; Returned 12p; Net profit 10p.

Life in the Slow Lane (Monday Morning Grind) Another BMW bites the dust on the hard shoulder of the Westbound M20 J4. Time Delay: 4 Plays of Nickelbacks "Someday".
	Chad and the boyz, providing today's motorway madness timing delay

Little Victory
Usual 2p profit on a cup of Campachino.

Missed Little Victory
Post-it on coffee machine, claiming someone had left 64p in there by mistake.

Current Spins
Dido - Life for Rent: Unnerving and brilliant
Green Day - Dookie: At last, it found it's way into the collection
Joni Mitchell - Ladies of the Canyon: Old Friends, new eyes.
Metallica - Garage Inc: 12.99 HMV... essential
Yes - Yessongs... 12.00 from local 2nd Hand CD man
Richard Ashcroft - Alone with everybody: In 2 CD Box Set Sainsbugs... Tenner
Richard Ashcroft - Human Condition: In 2 CD Box Set Sainsbugs... Tenner
The Stone Roses - The Very Best of: Hmmmm jury out still
Bjork - Greatest Hits: Waiftastic
Genesis - Selling England by the Pound: "Paper Late"

Little Victory
Campachino 18p; Inserted 20p; Return 7p; Net profit 5p

Life in the Slow Lane
3 car pile-up, Northbound M23. Causing much rubber-necking southbound delays. Duration 2.7 plays of Fish's "Gentleman's Excuse Me".

Little Victory
Tasty Cup of Campachino 18p; Inserted 20p; Returned 4p; net profit 2p

Sublime Grime
"ALSO AVAILABLE IN BLUE" on back of blue transit. A quaint re-working of the white theme, unfortunately, this was only visible as the sun caught the van and a particular angle. West bound M20 lower tributaries

Little Victory
2p left in coffee machine.

Bad office Humour Example
"I collect jars because I'm a Java expert"

Litlle Victory
Mars bar 35p; Inserted 50p; 21p change; Net profit 6p.

Life in the Slow Lane Rain = 40% delay. Journey Time: 1.8 plays of YES - "90125"
	Yes 90125 supplied todays Journey timing, ironically approximately 90.125 mins

Bad Office Humour Example
On hearing that office secretary had moved desks...."Why is it called a stationary cupboard if it keeps moving around".
On being explained on the concept of "Blogging" and using the "Where's Raed" as an example, same individual quoted as saying "He could've made a bomb out that".

Little Victory
1p left in coffee machine by secondary hot water machine.

Life in the Slow Lane
Two refugees on hard shoulder. South bound M23 J8>J9.

Little Victory
Tasty cup of Campachino 18p; Inserted 10p; 4p Change; Net profit 12p.

Whinge Grime
A rather unoriginal "I WISH MY GIRLFRIEND WAS AS DIRTY AS THIS VAN!" and "CLEAN ME!" on a white van, clockwise M25 J5>J6... highly unoriginal.

Little Victory
Campachino 18p; Inserted 20p; 16p returned; Net profit 14p.

Life in the Slow Lane
Fog causing a congested, steady drive.
Noticed smart sporty Lotus type thing on M25 (red with White Trans-am Stripes), saw the same car 20 miles later crunched on the Crawley Way Roundabout... distressing, especially since it collided with an unscathed soul-less Volvo.
Duration: 40mins of WUTW and 5 Bob Dylan Songs (1 played twice).

Little Victory
2p left in vending machine whilst getting hot water.

Deutsche Grime
"AIR BAG TEST" and "BIG MACK IS BACK" scrawled across the back of a German mid-sized truck, obviously not written by the driver of said vehicle other it would have said "Luftbeutel Test" and "Grosses Mack ist zurück".

Life in Slow Lane Well the little blighters are back to school so it was slow going getting onto the M20 (Time Delay: Two Tracks of an illegally copied Sheryl Crow CD), plus the usual crawl past Clackett Lane (Time Delay: Approx 3 Radio 2 Traffic Reports).
	Sheryl Crow, illegally supplying the time delay measurement techniques today.

Little Victory 2
Mars bar 35p; Price Paid 33p; 2p Profit.

Current Spins
Fleetwood Mac - The Best of Peter Green's: [*****] alt.trendy.retro.blues
Bob Dylan - Blond on Blond: [****1/2] alt.poets.genius.really.just-listen
Frank Zappa - Shiek Yerbouti: [****] alt.music.wakeup.integrity.alert
Delta Goodram - Innocent Eyes: [***1/2] aus.music.quite.decent
Alison Krauss and The Union Station - New Favourite: [****]rec.music.jugs.bluegrass
Thin Lizzy - Live and Dangerous: [*****] uk.music.much.missed
Stevie Wonder - The Definitive Collection: [*****] alt.brighter.thanasummersday
Eminen - The Slim Shady LP: [***1/2] rec.music.misunderstood.questionmark

Little Victory
2p left in Coffee Machine upon idle inspection.

Life in the Slow Lane
Large tanker having puncture repaired. M23 Southbound. Closed inside lane. Time Delay: 3 Neil Diamond songs.

Little Victory
Casual check of coffee vending machine results in net gain of 2p.

Mr Grime (sdale)
Superb cartoon stork, carrying 'bundle of joy' on back of white van, westbound M26. Artist should be proud. Technique uncertain...likely to be one of;
a) Hand drawn
b) Stencil, cleaning exposed area with cloth
c) Remaining outline from previous owners advertising sticker

Little Victory Pt2
Tasty Cup of frothy Campachino 18p; Exact Money Entered; 9p returned;

Little Victory
Water - Free vend; Change 2p; Profit 2p;

Real Madrid #23 Watch
PC World Crawley

Little Victory
Tasty cup of Campachino 18p: Insert 50p; Change 37p; Profit 5p.

Life in the Slow Lane

Gatwick Airport holiday traffic delaying southbound M23 traffic. Total Journey time 1.4 plays of Buckcherry's "Time Bomb" [***]
	Today's journey Timing brought to you courtesy of Buckcherry

Life in the Slow Lane
34 Blue Portraloos, heading southbound M23.

Life in the Slow Lane
Big Bemuddlement "Hi" to the person who was wearing the Peugeot 206 this morning on the southbound M23 J9. Bemuddlement apologies that we didn't see your courteous 'flashing headlamp' signal, (allowing Skye to overtake the Juggernaut she was rapidly heading on collision course with). Bemuddlement suggests that maybe next time, you signal whilst not driving in the Blind Spot of the vehicle you are attempting to signal and instead perform the indication from the position where you threw those splendid 'hand gestures', which were clearly visible due to your subsequent, excellent positioning.

KTB Spotting
KTB - Major to Minor on R2.
Major = "Eat The Music"
Minor = "Army Dreamers"

Time Observation
Vending Machine: BST - 1hr
Coffee Machine : Correct BST
Kitchen Clock : BST + 1hr

Grime Decrease
A very minimalist "H" spotted on back of white transit, lower tributaries of the west bound M20.

Life in the Slow Lane
Minor collision J6 M25, two non-descript vehicles. Time Delay: 0.75 8:00am News Bulletin.

Current "Reds"

Harry Potter - Order of the Phoenix: JK Rowling [***1/2]
700+ pages, weighty, fun, full of Hogwarts Elaboration... but it left me disappointed... I wanted more than a trivial 700 page filler between books 4 and 6 & 7. Set up nicely though.

Ghost Rider: Neil Peart [****]
How does a man survive the deaths of his daughter and wife within 11 months? He gets on a motorcycle and rides. Outstanding account of one man's struggle to exist.

Chasing Down the Dawn - Jewel [*****]
OK I'm a bit biased here. Big Jewel fan. Incredible insight into the dreams and motives of the singer/songwriter.

Little Victory
Own Coffee; Hot Water Only; 6p Profit.

Current Spins - Point Proven
Bemuddlement is a great believer that all great albums are under 40mins in duration. No better proof can be found, at the moment, in two of the latest spinning aquisitions

The Darkness - Permission to Land [38mins 11secs]: [*****]
Four letter words, sex, alcolhol abuse, sex, satanism, sex, a Naked woman on the sleeve and sex. Its NWOBHM meets Guns'N'Roses, meets AC/DC, meets Geedy Lee on Acid, meets The Scorpions, meets Hipnogsis. They even nick a riff from "Red Barchetta" (Stuck In A Rut) and I'm sure there's a bit of Brian May's "Starfleet" inspiration on here... but hey... this works.... and it works well. They even have a "pointy tail" in there logo... it feels like 1979 all over again or is that 1988? Not since Axl Rose have we heard a heard singer who can cram so many Syllables into a line.
"Be they Angels or but men who rock"? You decide....

Electric Six - Fire [38mins 20secs]: [****]
Any band that passes a nodding wink to Tubeway Army's "Down In the park (I Invented the Night) and Van Halen's Panama (I'm the Bomb) is alright by me. It's "Fire at the Taco Bell". Disappointing lack of video-extras in this day and age.. costs the CD a "*".

Life in the Slow Lane
Rain: Time Delay = 18 plays of Electric Six's "Gaybar"

Little Victory
Pack of 3 Jaffa Cakes; Price 35p; Inserted 40p; Change returned 17p; Net profit 12p.

Little Victory/Recovering Vegetarian
Tasty cup of chicken soup price 15p; Inserted 20p; Change given 7p; Net profit 2p

Accidents Can Happen
But not usually with 200 people, forced out in the rain, due to a fire alarm,looking on. Splendid collision betewen Parcel Force van and unidentified car. Fleeming Way/A23 roundabout.

Little Victory
2 cups of free vend sparkling water; Price paid 0.00; 4p returned; Net profit 4p.

Grime Watch
"IF YOU WANT AN EXAMPLE OF A DOOS, SEE DRIVER" spotted on the back of metallic blue Citroen dispatch van. Manor Royal, Crawley.

Life in the Slow Lane
Peugeot 206 pointing the wrong direction on the Crawley Way roundabout. Lack of passenger side suggests it was driven by the same idiot in the BMW, that cut me up last week. Time Delay: 0.5 plays of Electric 6 - "Gaybar".

Grime Watch
A rather unoriginal "ALSO AVAILABLE IN WHITE" on the back of a white transit van, westbound M20 approaching J4.

Little Defeat
Campachino (SE Rate) 18p; Inserted 50p; Change given 27p; Net Loss 5p

Dull Man Confirmation #2
Luggage carousel Gatwick North terminal (UK Internal): Clockwise

Dull Man Confirmation
Luggage carousel 2 - Manchester Airport: Clockwise

Little Victory on Tour
Tasty cup of campanchino 12p; Price paid 4p ; Net profit 8p.

Theater of Dreams
Bemuddlement is ashamed to report Old Trafford has been visited.

#23 Your time has come
Spotted Manchester city centre 11pm+, single white female wearing "Real Madrid" white rugby shirt with #23 on the back.

Live from Manchester
First remote posting to the Bemuddlement Blooger. Strange to see children who can legitimately wear Manchester United shirts.

Life in the Slow Lane
Spectacular collision of car and road sign, Running Horse roundabout onto the M20 at J6, coupled with 4 car shunt just before J4. Time Delay: 2 Fresh breath Mints (Air Surge).
Special mention to the complete j*rk on the Crawley Way roundabout this morning , who clearly thinks that the 3rd Lane was for the 2nd Exit... may a large heavy weight fall through the roof of your silver convertible.



Strange Currencies
Spotted in change. Falkland Islands 20p piece, complete with sheep.

Falkland Islands 20p Piece... yesterday

Little Victory
Packet of tasty Bacon Flavour Wheat Crunchies (172 cals), 30p; Price paid 8p; Net profit 22p.

Life in the Slow Lane
As reported yesterday, not only are the Clackett Lane services now host a "Total" garage, the whole service area is now "roadchef" and there is a 24/7 "Spar" convenience store at the fuel station.
To mark this momentous occasion, a tethered advertising balloon is today floating over the M25 at this point, slowing traffic down even more, whilst curious drivers try to see what's written on the dirigible.

Life in the Slow Lane
Well it was Monday and it was raining, so that kind of explains the tedious 90 minute drive and the 40 minutes it took to get through the M26/M25 snarl-up today. This gave me the unpleasant chance to observe a man urinating on the hard shoulder.
Also noted that the service station at Clackett Lane is no longer "Elf 24/7" but "Total" and has been lovingly redecorated in Corporate Red. Fuel is still 5p/litre dearer than anywhere else.
Time Delay: One unexpected play of Bob Dylan's "Nashville Skyline".

Little Victory
DVD Organisers. 5.99UKP each. Buy 2 get 3rd Free. Expected price (with 5% loyality discount) 11.39UKP. Price paid 6.68UKP. Net profit 4.71UKP.

Current Spins

0304 - Jewel: [****]
Storming. Jewel goes Pop. Enlisting Shakeria's producer Lester A. Mendez should ensure plenty of UK airplay when it's released here in September. Superficially different, it's still Jewel underneath. 'Haunted' is worth 4 stars on it's own. Not for those irritating Jewel fans who scream for "Foolish Games" all the way through the gig.

Arachnophobiac - MSG: [***1/2]
Pleasant return to listenable melodic metal from one of the world's most accomplished guitarists. First MSG album we here at Bemuddlement have REALLY liked for years.

Little Victory
2p left in coffee machine. Tasty cup of campachino 18p; price paid 16p; Net profit 2p.

Rush Spot
"The Spirit of Radio" Planet Rock 22:53. :-)))))))))))

Repeat Grime Offender
"ENCON" truck spotted again. Westbound M26.

National Grime
"SOD BECKHAM" inscribed on the back of a Spanish Catalonian truck, southern stretches of the M25.

Harbinger of Spring
Two foreign looking gentlemen strolling eastbound on the hard shoulder of the M26.

Current Spins
St Anger: Metallica [***]
Why does one of Lars Ulrich's Toms sound like he is hitting an empty paint can? Average output from the former greatest band in the world. Still, deluxe edition contains a DVD of the whole album performed live... not bad.

Fallen: Evanescence [****1/2]
Stunning, but gets a bit too "Linkin Parkish" on fleeting occasions, which at the moment is terribly unfashionable.

Everything Must Go: Steely Dan [*]
Please just go away now. Bland effort from the duo that once brought us "Reelin' in the Years", "Black Friday", "Babylon Sisters", "Show Biz Kids", "Peg", "Hey Nineteen", "Bodhisattva", "Bad Sneakers" etc etc etc etc etc... get the message?

For Those ABout To Rock: AC/DC [***1/2]
Pleasant surprise after all these years. Readjusted the theory that nothing beyond "Back in Black" is worth listening too.

It's Grime in the Slow Lane
ENCON" spotted, inscribed twice on the back of medium size truck south bound M23. Most odd
Other observations included that lifting machine manufacturers KRUPP use John Bonham's symbol as their logo. Little does Dave Grohl realise that everytime he exposes his right wrist, on the many music videos he now appears, he is advertising Krupp Cranes... or maybe he does...

Krupp Logo

Led Zepplin - DVD Essential *****+
Within 30 secs of watching this DVD (I dipped in to see Jimmy Playing "Going to California"), it became clear that this is THE music DVD release so far. For all too long all us fans have had to hold onto have been the Albums, then the remastered CDs, or the Video of TSRTS (and then the DVD). This DVD is essential and will reside in my player for months.

Grime Aggressor
"DO NOT PARK HERE" inscribed on the side of largish, white transit. Spotted Manor Royal, Crawley.

Life in the Slow Lane
Parched tarmac near Clacket Lane showing indication of earlier accident, causing 8 mile tailback on M26. Time Delay: 1 play of the entire White Stripe's "Elephant" album

Life in the Slow Lane
White van in ditch off the M20 approaching J4. Delay = 0.4 plays of Badly Drawn Boy's "Have You Fed the Fish".
Three car shunt at Clacket Lane blocking outside lane. Luckily arrived just as it happened, minot delay....oh and it was raining so the queue on the M26 was approx 7 miles.

Current Spin : How the West Was Won - Led Zeppelin (****7/8) Now I like Led Zeppelin more than the next man, unless that man is Jimmy Page. This is essential, don't get me wrong.......but do we really need a 19 minute version of "Moby Dick"....****
	At least 14 minutes too long, John Henry Bonham...not yesterday

Little Victory
48p left in coffee machine. Free campachino + 30p profit

Obscene Crime Squad
"TOSSA" inscribed on back of white KONE elevators transit van, south bound M23 approaching J9.

Life in the Slow Lane
Come home to a real fire....or rather a spectacular car fire, hard shoulder, south bound M23 between J8 and J9. Time delay 1.4 plays of a rather splendid Trevor Rabin Yes tune.

Life in the Slow Lane
Accident, upper tributaries of the M20 causing delays back to Westbound J3. Delay 1.8 plays of "Staind- Been A While".

Tori Spot
BBC6 23:30, Bruce Dickinson plays Tori doing "Winter" from a BBC session circa 1992. Nice piano change on the "Mirror, Mirror...." line.
Shrills the "hair is grey and fire is burning " line.
Nice breathy last line.

Bruce's Comment: " I think that's beautiful... let's get her on the show and talk about Piano's"

Know what it is yet?...Suggestions to Bemuddlement e-mail

ATATTAGGTTTTTACCTACCCAGGAAAAGCCAACCAACCTCGATCTCTTGTAGATCTGTTCTCTAAACGAACTTTAAAA

TCTGTGTAGCTGTCGCTCGGCTGCATGCCTAGTGCACCTACGCAGTATAAACAATAATAAATTTTACTGTCGTTGACAA

GAAACGAGTAACTCGTCCCTCTTCTGCAGACTGCTTACGGTTTCGTCCGTGTTGCAGTCGATCATCAGCATACCTAGGT

TTCGTCCGGGTGTGACCGAAAGGTAAGATGGAGAGCCTTGTTCTTGGTGTCAACGAGAAAACACACGTCCAACTCAGTT

TGCCTGTCCTTCAGGTTAGAGACGTGCTAGTGCGTGGCTTCGGGGACTCTGTGGAAGAGGCCCTATCGGAGGCACGTGA

ACACCTCAAAAATGGCACTTGTGGTCTAGTAGAGCTGGAAAAAGGCGTACTGCCCCAGCTTGAACAGCCCTATGTGTTC

ATTAAACGTTCTGATGCCTTAAGCACCAATCACGGCCACAAGGTCGTTGAGCTGGTTGCAGAAATGGACGGCATTCAGT

ACGGTCGTAGCGGTATAACACTGGGAGTACTCGTGCCACATGTGGGCGAAACCCCAATTGCATACCGCAATGTTCTTCT

TCGTAAGAACGGTAATAAGGGAGCCGGTGGTCATAGCTATGGCATCGATCTAAAGTCTTATGACTTAGGTGACGAGCTT

GGCACTGATCCCATTGAAGATTATGAACAAAACTGGAACACTAAGCATGGCAGTGGTGCACTCCGTGAACTCACTCGTG

AGCTCAATGGAGGTGCAGTCACTCGCTATGTCGACAACAATTTCTGTGGCCCAGATGGGTACCCTCTTGATTGCATCAA

AGATTTTCTCGCACGCGCGGGCAAGTCAATGTGCACTCTTTCCGAACAACTTGATTACATCGAGTCGAAGAGAGGTGTC

TACTGCTGCCGTGACCATGAGCATGAAATTGCCTGGTTCACTGAGCGCTCTGATAAGAGCTACGAGCACCAGACACCCT

TCGAAATTAAGAGTGCCAAGAAATTTGACACTTTCAAAGGGGAATGCCCAAAGTTTGTGTTTCCTCTTAACTCAAAAGT

CAAAGTCATTCAACCACGTGTTGAAAAGAAAAAGACTGAGGGTTTCATGGGGCGTATACGCTCTGTGTACCCTGTTGCA

TCTCCACAGGAGTGTAACAATATGCACTTGTCTACCTTGATGAAATGTAATCATTGCGATGAAGTTTCATGGCAGACGT

GCGACTTTCTGAAAGCCACTTGTGAACATTGTGGCACTGAAAATTTAGTTATTGAAGGACCTACTACATGTGGGTACCT

ACCTACTAATGCTGTAGTGAAAATGCCATGTCCTGCCTGTCAAGACCCAGAGATTGGACCTGAGCATAGTGTTGCAGAT

TATCACAACCACTCAAACATTGAAACTCGACTCCGCAAGGGAGGTAGGACTAGATGTTTTGGAGGCTGTGTGTTTGCCT

ATGTTGGCTGCTATAATAAGCGTGCCTACTGGGTTCCTCGTGCTAGTGCTGATATTGGCTCAGGCCATACTGGCATTAC

TGGTGACAATGTGGAGACCTTGAATGAGGATCTCCTTGAGATACTGAGTCGTGAACGTGTTAACATTAACATTGTTGGC

GATTTTCATTTGAATGAAGAGGTTGCCATCATTTTGGCATCTTTCTCTGCTTCTACAAGTGCCTTTATTGACACTATAA

AGAGTCTTGATTACAAGTCTTTCAAAACCATTGTTGAGTCCTGCGGTAACTATAAAGTTACCAAGGGAAAGCCCGTAAA

AGGTGCTTGGAACATTGGACAACAGAGATCAGTTTTAACACCACTGTGTGGTTTTCCCTCACAGGCTGCTGGTGTTATC

AGATCAATTTTTGCGCGCACACTTGATGCAGCAAACCACTCAATTCCTGATTTGCAAAGAGCAGCTGTCACCATACTTG

ATGGTATTTCTGAACAGTCATTACGTCTTGTCGACGCCATGGTTTATACTTCAGACCTGCTCACCAACAGTGTCATTAT

TATGGCATATGTAACTGGTGGTCTTGTACAACAGACTTCTCAGTGGTTGTCTAATCTTTTGGGCACTACTGTTGAAAAA

CTCAGGCCTATCTTTGAATGGATTGAGGCGAAACTTAGTGCAGGAGTTGAATTTCTCAAGGATGCTTGGGAGATTCTCA

AATTTCTCATTACAGGTGTTTTTGACATCGTCAAGGGTCAAATACAGGTTGCTTCAGATAACATCAAGGATTGTGTAAA

ATGCTTCATTGATGTTGTTAACAAGGCACTCGAAATGTGCATTGATCAAGTCACTATCGCTGGCGCAAAGTTGCGATCA

CTCAACTTAGGTGAAGTCTTCATCGCTCAAAGCAAGGGACTTTACCGTCAGTGTATACGTGGCAAGGAGCAGCTGCAAC

TACTCATGCCTCTTAAGGCACCAAAAGAAGTAACCTTTCTTGAAGGTGATTCACATGACACAGTACTTACCTCTGAGGA

GGTTGTTCTCAAGAACGGTGAACTCGAAGCACTCGAGACGCCCGTTGATAGCTTCACAAATGGAGCTATCGTTGGCACA

CCAGTCTGTGTAAATGGCCTCATGCTCTTAGAGATTAAGGACAAAGAACAATACTGCGCATTGTCTCCTGGTTTACTGG

CTACAAACAATGTCTTTCGCTTAAAAGGGGGTGCACCAATTAAAGGTGTAACCTTTGGAGAAGATACTGTTTGGGAAGT

TCAAGGTTACAAGAATGTGAGAATCACATTTGAGCTTGATGAACGTGTTGACAAAGTGCTTAATGAAAAGTGCTCTGTC

TACACTGTTGAATCCGGTACCGAAGTTACTGAGTTTGCATGTGTTGTAGCAGAGGCTGTTGTGAAGACTTTACAACCAG

TTTCTGATCTCCTTACCAACATGGGTATTGATCTTGATGAGTGGAGTGTAGCTACATTCTACTTATTTGATGATGCTGG

TGAAGAAAACTTTTCATCACGTATGTATTGTTCCTTTTACCCTCCAGATGAGGAAGAAGAGGACGATGCAGAGTGTGAG

GAAGAAGAAATTGATGAAACCTGTGAACATGAGTACGGTACAGAGGATGATTATCAAGGTCTCCCTCTGGAATTTGGTG

CCTCAGCTGAAACAGTTCGAGTTGAGGAAGAAGAAGAGGAAGACTGGCTGGATGATACTACTGAGCAATCAGAGATTGA

GCCAGAACCAGAACCTACACCTGAAGAACCAGTTAATCAGTTTACTGGTTATTTAAAACTTACTGACAATGTTGCCATT

AAATGTGTTGACATCGTTAAGGAGGCACAAAGTGCTAATCCTATGGTGATTGTAAATGCTGCTAACATACACCTGAAAC

ATGGTGGTGGTGTAGCAGGTGCACTCAACAAGGCAACCAATGGTGCCATGCAAAAGGAGAGTGATGATTACATTAAGCT

AAATGGCCCTCTTACAGTAGGAGGGTCTTGTTTGCTTTCTGGACATAATCTTGCTAAGAAGTGTCTGCATGTTGTTGGA

CCTAACCTAAATGCAGGTGAGGACATCCAGCTTCTTAAGGCAGCATATGAAAATTTCAATTCACAGGACATCTTACTTG

CACCATTGTTGTCAGCAGGCATATTTGGTGCTAAACCACTTCAGTCTTTACAAGTGTGCGTGCAGACGGTTCGTACACA

GGTTTATATTGCAGTCAATGACAAAGCTCTTTATGAGCAGGTTGTCATGGATTATCTTGATAACCTGAAGCCTAGAGTG

GAAGCACCTAAACAAGAGGAGCCACCAAACACAGAAGATTCCAAAACTGAGGAGAAATCTGTCGTACAGAAGCCTGTCG

ATGTGAAGCCAAAAATTAAGGCCTGCATTGATGAGGTTACCACAACACTGGAAGAAACTAAGTTTCTTACCAATAAGTT

ACTCTTGTTTGCTGATATCAATGGTAAGCTTTACCATGATTCTCAGAACATGCTTAGAGGTGAAGATATGTCTTTCCTT

GAGAAGGATGCACCTTACATGGTAGGTGATGTTATCACTAGTGGTGATATCACTTGTGTTGTAATACCCTCCAAAAAGG

CTGGTGGCACTACTGAGATGCTCTCAAGAGCTTTGAAGAAAGTGCCAGTTGATGAGTATATAACCACGTACCCTGGACA

AGGATGTGCTGGTTATACACTTGAGGAAGCTAAGACTGCTCTTAAGAAATGCAAATCTGCATTTTATGTACTACCTTCA

GAAGCACCTAATGCTAAGGAAGAGATTCTAGGAACTGTATCCTGGAATTTGAGAGAAATGCTTGCTCATGCTGAAGAGA

CAAGAAAATTAATGCCTATATGCATGGATGTTAGAGCCATAATGGCAACCATCCAACGTAAGTATAAAGGAATTAAAAT

TCAAGAGGGCATCGTTGACTATGGTGTCCGATTCTTCTTTTATACTAGTAAAGAGCCTGTAGCTTCTATTATTACGAAG

CTGAACTCTCTAAATGAGCCGCTTGTCACAATGCCAATTGGTTATGTGACACATGGTTTTAATCTTGAAGAGGCTGCGC

GCTGTATGCGTTCTCTTAAAGCTCCTGCCGTAGTGTCAGTATCATCACCAGATGCTGTTACTACATATAATGGATACCT

CACTTCGTCATCAAAGACATCTGAGGAGCACTTTGTAGAAACAGTTTCTTTGGCTGGCTCTTACAGAGATTGGTCCTAT

TCAGGACAGCGTACAGAGTTAGGTGTTGAATTTCTTAAGCGTGGTGACAAAATTGTGTACCACACTCTGGAGAGCCCCG

TCGAGTTTCATCTTGACGGTGAGGTTCTTTCACTTGACAAACTAAAGAGTCTCTTATCCCTGCGGGAGGTTAAGACTAT

AAAAGTGTTCACAACTGTGGACAACACTAATCTCCACACACAGCTTGTGGATATGTCTATGACATATGGACAGCAGTTT

GGTCCAACATACTTGGATGGTGCTGATGTTACAAAAATTAAACCTCATGTAAATCATGAGGGTAAGACTTTCTTTGTAC

TACCTAGTGATGACACACTACGTAGTGAAGCTTTCGAGTACTACCATACTCTTGATGAGAGTTTTCTTGGTAGGTACAT

GTCTGCTTTAAACCACACAAAGAAATGGAAATTTCCTCAAGTTGGTGGTTTAACTTCAATTAAATGGGCTGATAACAAT

TGTTATTTGTCTAGTGTTTTATTAGCACTTCAACAGCTTGAAGTCAAATTCAATGCACCAGCACTTCAAGAGGCTTATT

ATAGAGCCCGTGCTGGTGATGCTGCTAACTTTTGTGCACTCATACTCGCTTACAGTAATAAAACTGTTGGCGAGCTTGG

TGATGTCAGAGAAACTATGACCCATCTTCTACAGCATGCTAATTTGGAATCTGCAAAGCGAGTTCTTAATGTGGTGTGT

AAACATTGTGGTCAGAAAACTACTACCTTAACGGGTGTAGAAGCTGTGATGTATATGGGTACTCTATCTTATGATAATC

TTAAGACAGGTGTTTCCATTCCATGTGTGTGTGGTCGTGATGCTACACAATATCTAGTACAACAAGAGTCTTCTTTTGT

TATGATGTCTGCACCACCTGCTGAGTATAAATTACAGCAAGGTACATTCTTATGTGCGAATGAGTACACTGGTAACTAT

CAGTGTGGTCATTACACTCATATAACTGCTAAGGAGACCCTCTATCGTATTGACGGAGCTCACCTTACAAAGATGTCAG

AGTACAAAGGACCAGTGACTGATGTTTTCTACAAGGAAACATCTTACACTACAACCATCAAGCCTGTGTCGTATAAACT

CGATGGAGTTACTTACACAGAGATTGAACCAAAATTGGATGGGTATTATAAAAAGGATAATGCTTACTATACAGAGCAG

CCTATAGACCTTGTACCAACTCAACCATTACCAAATGCGAGTTTTGATAATTTCAAACTCACATGTTCTAACACAAAAT

TTGCTGATGATTTAAATCAAATGACAGGCTTCACAAAGCCAGCTTCACGAGAGCTATCTGTCACATTCTTCCCAGACTT

GAATGGCGATGTAGTGGCTATTGACTATAGACACTATTCAGCGAGTTTCAAGAAAGGTGCTAAATTACTGCATAAGCCA

ATTGTTTGGCACATTAACCAGGCTACAACCAAGACAACGTTCAAACCAAACACTTGGTGTTTACGTTGTCTTTGGAGTA

CAAAGCCAGTAGATACTTCAAATTCATTTGAAGTTCTGGCAGTAGAAGACACACAAGGAATGGACAATCTTGCTTGTGA

AAGTCAACAACCCACCTCTGAAGAAGTAGTGGAAAATCCTACCATACAGAAGGAAGTCATAGAGTGTGACGTGAAAACT

ACCGAAGTTGTAGGCAATGTCATACTTAAACCATCAGATGAAGGTGTTAAAGTAACACAAGAGTTAGGTCATGAGGATC

TTATGGCTGCTTATGTGGAAAACACAAGCATTACCATTAAGAAACCTAATGAGCTTTCACTAGCCTTAGGTTTAAAAAC

AATTGCCACTCATGGTATTGCTGCAATTAATAGTGTTCCTTGGAGTAAAATTTTGGCTTATGTCAAACCATTCTTAGGA

CAAGCAGCAATTACAACATCAAATTGCGCTAAGAGATTAGCACAACGTGTGTTTAACAATTATATGCCTTATGTGTTTA

CATTATTGTTCCAATTGTGTACTTTTACTAAAAGTACCAATTCTAGAATTAGAGCTTCACTACCTACAACTATTGCTAA

AAATAGTGTTAAGAGTGTTGCTAAATTATGTTTGGATGCCGGCATTAATTATGTGAAGTCACCCAAATTTTCTAAATTG

TTCACAATCGCTATGTGGCTATTGTTGTTAAGTATTTGCTTAGGTTCTCTAATCTGTGTAACTGCTGCTTTTGGTGTAC

TCTTATCTAATTTTGGTGCTCCTTCTTATTGTAATGGCGTTAGAGAATTGTATCTTAATTCGTCTAACGTTACTACTAT

GGATTTCTGTGAAGGTTCTTTTCCTTGCAGCATTTGTTTAAGTGGATTAGACTCCCTTGATTCTTATCCAGCTCTTGAA

ACCATTCAGGTGACGATTTCATCGTACAAGCTAGACTTGACAATTTTAGGTCTGGCCGCTGAGTGGGTTTTGGCATATA

TGTTGTTCACAAAATTCTTTTATTTATTAGGTCTTTCAGCTATAATGCAGGTGTTCTTTGGCTATTTTGCTAGTCATTT

CATCAGCAATTCTTGGCTCATGTGGTTTATCATTAGTATTGTACAAATGGCACCCGTTTCTGCAATGGTTAGGATGTAC

ATCTTCTTTGCTTCTTTCTACTACATATGGAAGAGCTATGTTCATATCATGGATGGTTGCACCTCTTCGACTTGCATGA

TGTGCTATAAGCGCAATCGTGCCACACGCGTTGAGTGTACAACTATTGTTAATGGCATGAAGAGATCTTTCTATGTCTA

TGCAAATGGAGGCCGTGGCTTCTGCAAGACTCACAATTGGAATTGTCTCAATTGTGACACATTTTGCACTGGTAGTACA

TTCATTAGTGATGAAGTTGCTCGTGATTTGTCACTCCAGTTTAAAAGACCAATCAACCCTACTGACCAGTCATCGTATA

TTGTTGATAGTGTTGCTGTGAAAAATGGCGCGCTTCACCTCTACTTTGACAAGGCTGGTCAAAAGACCTATGAGAGACA

TCCGCTCTCCCATTTTGTCAATTTAGACAATTTGAGAGCTAACAACACTAAAGGTTCACTGCCTATTAATGTCATAGTT

TTTGATGGCAAGTCCAAATGCGACGAGTCTGCTTCTAAGTCTGCTTCTGTGTACTACAGTCAGCTGATGTGCCAACCTA

TTCTGTTGCTTGACCAAGCTCTTGTATCAGACGTTGGAGATAGTACTGAAGTTTCCGTTAAGATGTTTGATGCTTATGT

CGACACCTTTTCAGCAACTTTTAGTGTTCCTATGGAAAAACTTAAGGCACTTGTTGCTACAGCTCACAGCGAGTTAGCA

AAGGGTGTAGCTTTAGATGGTGTCCTTTCTACATTCGTGTCAGCTGCCCGACAAGGTGTTGTTGATACCGATGTTGACA

CAAAGGATGTTATTGAATGTCTCAAACTTTCACATCACTCTGACTTAGAAGTGACAGGTGACAGTTGTAACAATTTCAT

GCTCACCTATAATAAGGTTGAAAACATGACGCCCAGAGATCTTGGCGCATGTATTGACTGTAATGCAAGGCATATCAAT

GCCCAAGTAGCAAAAAGTCACAATGTTTCACTCATCTGGAATGTAAAAGACTACATGTCTTTATCTGAACAGCTGCGTA

AACAAATTCGTAGTGCTGCCAAGAAGAACAACATACCTTTTAGACTAACTTGTGCTACAACTAGACAGGTTGTCAATGT

CATAACTACTAAAATCTCACTCAAGGGTGGTAAGATTGTTAGTACTTGTTTTAAACTTATGCTTAAGGCCACATTATTG

TGCGTTCTTGCTGCATTGGTTTGTTATATCGTTATGCCAGTACATACATTGTCAATCCATGATGGTTACACAAATGAAA

TCATTGGTTACAAAGCCATTCAGGATGGTGTCACTCGTGACATCATTTCTACTGATGATTGTTTTGCAAATAAACATGC

TGGTTTTGACGCATGGTTTAGCCAGCGTGGTGGTTCATACAAAAATGACAAAAGCTGCCCTGTAGTAGCTGCTATCATT

ACAAGAGAGATTGGTTTCATAGTGCCTGGCTTACCGGGTACTGTGCTGAGAGCAATCAATGGTGACTTCTTGCATTTTC

TACCTCGTGTTTTTAGTGCTGTTGGCAACATTTGCTACACACCTTCCAAACTCATTGAGTATAGTGATTTTGCTACCTC

TGCTTGCGTTCTTGCTGCTGAGTGTACAATTTTTAAGGATGCTATGGGCAAACCTGTGCCATATTGTTATGACACTAAT

TTGCTAGAGGGTTCTATTTCTTATAGTGAGCTTCGTCCAGACACTCGTTATGTGCTTATGGATGGTTCCATCATACAGT

TTCCTAACACTTACCTGGAGGGTTCTGTTAGAGTAGTAACAACTTTTGATGCTGAGTACTGTAGACATGGTACATGCGA

AAGGTCAGAAGTAGGTATTTGCCTATCTACCAGTGGTAGATGGGTTCTTAATAATGAGCATTACAGAGCTCTATCAGGA

GTTTTCTGTGGTGTTGATGCGATGAATCTCATAGCTAACATCTTTACTCCTCTTGTGCAACCTGTGGGTGCTTTAGATG

TGTCTGCTTCAGTAGTGGCTGGTGGTATTATTGCCATATTGGTGACTTGTGCTGCCTACTACTTTATGAAATTCAGACG

TGTTTTTGGTGAGTACAACCATGTTGTTGCTGCTAATGCACTTTTGTTTTTGATGTCTTTCACTATACTCTGTCTGGTA

CCAGCTTACAGCTTTCTGCCGGGAGTCTACTCAGTCTTTTACTTGTACTTGACATTCTATTTCACCAATGATGTTTCAT

TCTTGGCTCACCTTCAATGGTTTGCCATGTTTTCTCCTATTGTGCCTTTTTGGATAACAGCAATCTATGTATTCTGTAT

TTCTCTGAAGCACTGCCATTGGTTCTTTAACAACTATCTTAGGAAAAGAGTCATGTTTAATGGAGTTACATTTAGTACC

TTCGAGGAGGCTGCTTTGTGTACCTTTTTGCTCAACAAGGAAATGTACCTAAAATTGCGTAGCGAGACACTGTTGCCAC

TTACACAGTATAACAGGTATCTTGCTCTATATAACAAGTACAAGTATTTCAGTGGAGCCTTAGATACTACCAGCTATCG

TGAAGCAGCTTGCTGCCACTTAGCAAAGGCTCTAAATGACTTTAGCAACTCAGGTGCTGATGTTCTCTACCAACCACCA

CAGACATCAATCACTTCTGCTGTTCTGCAGAGTGGTTTTAGGAAAATGGCATTCCCGTCAGGCAAAGTTGAAGGGTGCA

TGGTACAAGTAACCTGTGGAACTACAACTCTTAATGGATTGTGGTTGGATGACACAGTATACTGTCCAAGACATGTCAT

TTGCACAGCAGAAGACATGCTTAATCCTAACTATGAAGATCTGCTCATTCGCAAATCCAACCATAGCTTTCTTGTTCAG

GCTGGCAATGTTCAACTTCGTGTTATTGGCCATTCTATGCAAAATTGTCTGCTTAGGCTTAAAGTTGATACTTCTAACC

CTAAGACACCCAAGTATAAATTTGTCCGTATCCAACCTGGTCAAACATTTTCAGTTCTAGCATGCTACAATGGTTCACC

ATCTGGTGTTTATCAGTGTGCCATGAGACCTAATCATACCATTAAAGGTTCTTTCCTTAATGGATCATGTGGTAGTGTT

GGTTTTAACATTGATTATGATTGCGTGTCTTTCTGCTATATGCATCATATGGAGCTTCCAACAGGAGTACACGCTGGTA

CTGACTTAGAAGGTAAATTCTATGGTCCATTTGTTGACAGACAAACTGCACAGGCTGCAGGTACAGACACAACCATAAC

ATTAAATGTTTTGGCATGGCTGTATGCTGCTGTTATCAATGGTGATAGGTGGTTTCTTAATAGATTCACCACTACTTTG

AATGACTTTAACCTTGTGGCAATGAAGTACAACTATGAACCTTTGACACAAGATCATGTTGACATATTGGGACCTCTTT

CTGCTCAAACAGGAATTGCCGTCTTAGATATGTGTGCTGCTTTGAAAGAGCTGCTGCAGAATGGTATGAATGGTCGTAC

TATCCTTGGTAGCACTATTTTAGAAGATGAGTTTACACCATTTGATGTTGTTAGACAATGCTCTGGTGTTACCTTCCAA

GGTAAGTTCAAGAAAATTGTTAAGGGCACTCATCATTGGATGCTTTTAACTTTCTTGACATCACTATTGATTCTTGTTC

AAAGTACACAGTGGTCACTGTTTTTCTTTGTTTACGAGAATGCTTTCTTGCCATTTACTCTTGGTATTATGGCAATTGC

TGCATGTGCTATGCTGCTTGTTAAGCATAAGCACGCATTCTTGTGCTTGTTTCTGTTACCTTCTCTTGCAACAGTTGCT

TACTTTAATATGGTCTACATGCCTGCTAGCTGGGTGATGCGTATCATGACATGGCTTGAATTGGCTGACACTAGCTTGT

CTGGTTATAGGCTTAAGGATTGTGTTATGTATGCTTCAGCTTTAGTTTTGCTTATTCTCATGACAGCTCGCACTGTTTA

TGATGATGCTGCTAGACGTGTTTGGACACTGATGAATGTCATTACACTTGTTTACAAAGTCTACTATGGTAATGCTTTA

GATCAAGCTATTTCCATGTGGGCCTTAGTTATTTCTGTAACCTCTAACTATTCTGGTGTCGTTACGACTATCATGTTTT

TAGCTAGAGCTATAGTGTTTGTGTGTGTTGAGTATTACCCATTGTTATTTATTACTGGCAACACCTTACAGTGTATCAT

GCTTGTTTATTGTTTCTTAGGCTATTGTTGCTGCTGCTACTTTGGCCTTTTCTGTTTACTCAACCGTTACTTCAGGCTT

ACTCTTGGTGTTTATGACTACTTGGTCTCTACACAAGAATTTAGGTATATGAACTCCCAGGGGCTTTTGCCTCCTAAGA

GTAGTATTGATGCTTTCAAGCTTAACATTAAGTTGTTGGGTATTGGAGGTAAACCATGTATCAAGGTTGCTACTGTACA

GTCTAAAATGTCTGACGTAAAGTGCACATCTGTGGTACTGCTCTCGGTTCTTCAACAACTTAGAGTAGAGTCATCTTCT

AAATTGTGGGCACAATGTGTACAACTCCACAATGATATTCTTCTTGCAAAAGACACAACTGAAGCTTTCGAGAAGATGG

TTTCTCTTTTGTCTGTTTTGCTATCCATGCAGGGTGCTGTAGACATTAATAGGTTGTGCGAGGAAATGCTCGATAACCG

TGCTACTCTTCAGGCTATTGCTTCAGAATTTAGTTCTTTACCATCATATGCCGCTTATGCCACTGCCCAGGAGGCCTAT

GAGCAGGCTGTAGCTAATGGTGATTCTGAAGTCGTTCTCAAAAAGTTAAAGAAATCTTTGAATGTGGCTAAATCTGAGT

TTGACCGTGATGCTGCCATGCAACGCAAGTTGGAAAAGATGGCAGATCAGGCTATGACCCAAATGTACAAACAGGCAAG

ATCTGAGGACAAGAGGGCAAAAGTAACTAGTGCTATGCAAACAATGCTCTTCACTATGCTTAGGAAGCTTGATAATGAT

GCACTTAACAACATTATCAACAATGCGCGTGATGGTTGTGTTCCACTCAACATCATACCATTGACTACAGCAGCCAAAC

TCATGGTTGTTGTCCCTGATTATGGTACCTACAAGAACACTTGTGATGGTAACACCTTTACATATGCATCTGCACTCTG

GGAAATCCAGCAAGTTGTTGATGCGGATAGCAAGATTGTTCAACTTAGTGAAATTAACATGGACAATTCACCAAATTTG

GCTTGGCCTCTTATTGTTACAGCTCTAAGAGCCAACTCAGCTGTTAAACTACAGAATAATGAACTGAGTCCAGTAGCAC

TACGACAGATGTCCTGTGCGGCTGGTACCACACAAACAGCTTGTACTGATGACAATGCACTTGCCTACTATAACAATTC

GAAGGGAGGTAGGTTTGTGCTGGCATTACTATCAGACCACCAAGATCTCAAATGGGCTAGATTCCCTAAGAGTGATGGT

ACAGGTACAATTTACACAGAACTGGAACCACCTTGTAGGTTTGTTACAGACACACCAAAAGGGCCTAAAGTGAAATACT

TGTACTTCATCAAAGGCTTAAACAACCTAAATAGAGGTATGGTGCTGGGCAGTTTAGCTGCTACAGTACGTCTTCAGGC

TGGAAATGCTACAGAAGTACCTGCCAATTCAACTGTGCTTTCCTTCTGTGCTTTTGCAGTAGACCCTGCTAAAGCATAT

AAGGATTACCTAGCAAGTGGAGGACAACCAATCACCAACTGTGTGAAGATGTTGTGTACACACACTGGTACAGGACAGG

CAATTACTGTAACACCAGAAGCTAACATGGACCAAGAGTCCTTTGGTGGTGCTTCATGTTGTCTGTATTGTAGATGCCA

CATTGACCATCCAAATCCTAAAGGATTCTGTGACTTGAAAGGTAAGTACGTCCAAATACCTACCACTTGTGCTAATGAC

CCAGTGGGTTTTACACTTAGAAACACAGTCTGTACCGTCTGCGGAATGTGGAAAGGTTATGGCTGTAGTTGTGACCAAC

TCCGCGAACCCTTGATGCAGTCTGCGGATGCATCAACGTTTTTAAACGGGTTTGCGGTGTAAGTGCAGCCCGTCTTACA

CCGTGCGGCACAGGCACTAGTACTGATGTCGTCTACAGGGCTTTTGATATTTACAACGAAAAAGTTGCTGGTTTTGCAA

AGTTCCTAAAAACTAATTGCTGTCGCTTCCAGGAGAAGGATGAGGAAGGCAATTTATTAGACTCTTACTTTGTAGTTAA

GAGGCATACTATGTCTAACTACCAACATGAAGAGACTATTTATAACTTGGTTAAAGATTGTCCAGCGGTTGCTGTCCAT

GACTTTTTCAAGTTTAGAGTAGATGGTGACATGGTACCACATATATCACGTCAGCGTCTAACTAAATACACAATGGCTG

ATTTAGTCTATGCTCTACGTCATTTTGATGAGGGTAATTGTGATACATTAAAAGAAATACTCGTCACATACAATTGCTG

TGATGATGATTATTTCAATAAGAAGGATTGGTATGACTTCGTAGAGAATCCTGACATCTTACGCGTATATGCTAACTTA

GGTGAGCGTGTACGCCAATCATTATTAAAGACTGTACAATTCTGCGATGCTATGCGTGATGCAGGCATTGTAGGCGTAC

TGACATTAGATAATCAGGATCTTAATGGGAACTGGTACGATTTCGGTGATTTCGTACAAGTAGCACCAGGCTGCGGAGT

TCCTATTGTGGATTCATATTACTCATTGCTGATGCCCATCCTCACTTTGACTAGGGCATTGGCTGCTGAGTCCCATATG

GATGCTGATCTCGCAAAACCACTTATTAAGTGGGATTTGCTGAAATATGATTTTACGGAAGAGAGACTTTGTCTCTTCG

ACCGTTATTTTAAATATTGGGACCAGACATACCATCCCAATTGTATTAACTGTTTGGATGATAGGTGTATCCTTCATTG

TGCAAACTTTAATGTGTTATTTTCTACTGTGTTTCCACCTACAAGTTTTGGACCACTAGTAAGAAAAATATTTGTAGAT

GGTGTTCCTTTTGTTGTTTCAACTGGATACCATTTTCGTGAGTTAGGAGTCGTACATAATCAGGATGTAAACTTACATA

GCTCGCGTCTCAGTTTCAAGGAACTTTTAGTGTATGCTGCTGATCCAGCTATGCATGCAGCTTCTGGCAATTTATTGCT

AGATAAACGCACTACATGCTTTTCAGTAGCTGCACTAACAAACAATGTTGCTTTTCAAACTGTCAAACCCGGTAATTTT

AATAAAGACTTTTATGACTTTGCTGTGTCTAAAGGTTTCTTTAAGGAAGGAAGTTCTGTTGAACTAAAACACTTCTTCT

TTGCTCAGGATGGCAACGCTGCTATCAGTGATTATGACTATTATCGTTATAATCTGCCAACAATGTGTGATATCAGACA

ACTCCTATTCGTAGTTGAAGTTGTTGATAAATACTTTGATTGTTACGATGGTGGCTGTATTAATGCCAACCAAGTAATC

GTTAACAATCTGGATAAATCAGCTGGTTTCCCATTTAATAAATGGGGTAAGGCTAGACTTTATTATGACTCAATGAGTT

ATGAGGATCAAGATGCACTTTTCGCGTATACTAAGCGTAATGTCATCCCTACTATAACTCAAATGAATCTTAAGTATGC

CATTAGTGCAAAGAATAGAGCTCGCACCGTAGCTGGTGTCTCTATCTGTAGTACTATGACAAATAGACAGTTTCATCAG

AAATTATTGAAGTCAATAGCCGCCACTAGAGGAGCTACTGTGGTAATTGGAACAAGCAAGTTTTACGGTGGCTGGCATA

ATATGTTAAAAACTGTTTACAGTGATGTAGAAACTCCACACCTTATGGGTTGGGATTATCCAAAATGTGACAGAGCCAT

GCCTAACATGCTTAGGATAATGGCCTCTCTTGTTCTTGCTCGCAAACATAACACTTGCTGTAACTTATCACACCGTTTC

TACAGGTTAGCTAACGAGTGTGCGCAAGTATTAAGTGAGATGGTCATGTGTGGCGGCTCACTATATGTTAAACCAGGTG

GAACATCATCCGGTGATGCTACAACTGCTTATGCTAATAGTGTCTTTAACATTTGTCAAGCTGTTACAGCCAATGTAAA

TGCACTTCTTTCAACTGATGGTAATAAGATAGCTGACAAGTATGTCCGCAATCTACAACACAGGCTCTATGAGTGTCTC

TATAGAAATAGGGATGTTGATCATGAATTCGTGGATGAGTTTTACGCTTACCTGCGTAAACATTTCTCCATGATGATTC

TTTCTGATGATGCCGTTGTGTGCTATAACAGTAACTATGCGGCTCAAGGTTTAGTAGCTAGCATTAAGAACTTTAAGGC

AGTTCTTTATTATCAAAATAATGTGTTCATGTCTGAGGCAAAATGTTGGACTGAGACTGACCTTACTAAAGGACCTCAC

GAATTTTGCTCACAGCATACAATGCTAGTTAAACAAGGAGATGATTACGTGTACCTGCCTTACCCAGATCCATCAAGAA

TATTAGGCGCAGGCTGTTTTGTCGATGATATTGTCAAAACAGATGGTACACTTATGATTGAAAGGTTCGTGTCACTGGC

TATTGATGCTTACCCACTTACAAAACATCCTAATCAGGAGTATGCTGATGTCTTTCACTTGTATTTACAATACATTAGA

AAGTTACATGATGAGCTTACTGGCCACATGTTGGACATGTATTCCGTAATGCTAACTAATGATAACACCTCACGGTACT

GGGAACCTGAGTTTTATGAGGCTATGTACACACCACATACAGTCTTGCAGGCTGTAGGTGCTTGTGTATTGTGCAATTC

ACAGACTTCACTTCGTTGCGGTGCCTGTATTAGGAGACCATTCCTATGTTGCAAGTGCTGCTATGACCATGTCATTTCA

ACATCACACAAATTAGTGTTGTCTGTTAATCCCTATGTTTGCAATGCCCCAGGTTGTGATGTCACTGATGTGACACAAC

TGTATCTAGGAGGTATGAGCTATTATTGCAAGTCACATAAGCCTCCCATTAGTTTTCCATTATGTGCTAATGGTCAGGT

TTTTGGTTTATACAAAAACACATGTGTAGGCAGTGACAATGTCACTGACTTCAATGCGATAGCAACATGTGATTGGACT

AATGCTGGCGATTACATACTTGCCAACACTTGTACTGAGAGACTCAAGCTTTTCGCAGCAGAAACGCTCAAAGCCACTG

AGGAAACATTTAAGCTGTCATATGGTATTGCCACTGTACGCGAAGTACTCTCTGACAGAGAATTGCATCTTTCATGGGA

GGTTGGAAAACCTAGACCACCATTGAACAGAAACTATGTCTTTACTGGTTACCGTGTAACTAAAAATAGTAAAGTACAG

ATTGGAGAGTACACCTTTGAAAAAGGTGACTATGGTGATGCTGTTGTGTACAGAGGTACTACGACATACAAGTTGAATG

TTGGTGATTACTTTGTGTTGACATCTCACACTGTAATGCCACTTAGTGCACCTACTCTAGTGCCACAAGAGCACTATGT

GAGAATTACTGGCTTGTACCCAACACTCAACATCTCAGATGAGTTTTCTAGCAATGTTGCAAATTATCAAAAGGTCGGC

ATGCAAAAGTACTCTACACTCCAAGGACCACCTGGTACTGGTAAGAGTCATTTTGCCATCGGACTTGCTCTCTATTACC

CATCTGCTCGCATAGTGTATACGGCATGCTCTCATGCAGCTGTTGATGCCCTATGTGAAAAGGCATTAAAATATTTGCC

CATAGATAAATGTAGTAGAATCATACCTGCGCGTGCGCGCGTAGAGTGTTTTGATAAATTCAAAGTGAATTCAACACTA

GAACAGTATGTTTTCTGCACTGTAAATGCATTGCCAGAAACAACTGCTGACATTGTAGTCTTTGATGAAATCTCTATGG

CTACTAATTATGACTTGAGTGTTGTCAATGCTAGACTTCGTGCAAAACACTACGTCTATATTGGCGATCCTGCTCAATT

ACCAGCCCCCCGCACATTGCTGACTAAAGGCACACTAGAACCAGAATATTTTAATTCAGTGTGCAGACTTATGAAAACA

ATAGGTCCAGACATGTTCCTTGGAACTTGTCGCCGTTGTCCTGCTGAAATTGTTGACACTGTGAGTGCTTTAGTTTATG

ACAATAAGCTAAAAGCACACAAGGATAAGTCAGCTCAATGCTTCAAAATGTTCTACAAAGGTGTTATTACACATGATGT

TTCATCTGCAATCAACAGACCTCAAATAGGCGTTGTAAGAGAATTTCTTACACGCAATCCTGCTTGGAGAAAAGCTGTT

TTTATCTCACCTTATAATTCACAGAACGCTGTAGCTTCAAAAATCTTAGGATTGCCTACGCAGACTGTTGATTCATCAC

AGGGTTCTGAATATGACTATGTCATATTCACACAAACTACTGAAACAGCACACTCTTGTAATGTCAACCGCTTCAATGT

GGCTATCACAAGGGCAAAAATTGGCATTTTGTGCATAATGTCTGATAGAGATCTTTATGACAAACTGCAATTTACAAGT

CTAGAAATACCACGTCGCAATGTGGCTACATTACAAGCAGAAAATGTAACTGGACTTTTTAAGGACTGTAGTAAGATCA

TTACTGGTCTTCATCCTACACAGGCACCTACACACCTCAGCGTTGATATAAAGTTCAAGACTGAAGGATTATGTGTTGA

CATACCAGGCATACCAAAGGACATGACCTACCGTAGACTCATCTCTATGATGGGTTTCAAAATGAATTACCAAGTCAAT

GGTTACCCTAATATGTTTATCACCCGCGAAGAAGCTATTCGTCACGTTCGTGCGTGGATTGGCTTTGATGTAGAGGGCT

GTCATGCAACTAGAGATGCTGTGGGTACTAACCTACCTCTCCAGCTAGGATTTTCTACAGGTGTTAACTTAGTAGCTGT

ACCGACTGGTTATGTTGACACTGAAAATAACACAGAATTCACCAGAGTTAATGCAAAACCTCCACCAGGTGACCAGTTT

AAACATCTTATACCACTCATGTATAAAGGCTTGCCCTGGAATGTAGTGCGTATTAAGATAGTACAAATGCTCAGTGATA

CACTGAAAGGATTGTCAGACAGAGTCGTGTTCGTCCTTTGGGCGCATGGCTTTGAGCTTACATCAATGAAGTACTTTGT

CAAGATTGGACCTGAAAGAACGTGTTGTCTGTGTGACAAACGTGCAACTTGCTTTTCTACTTCATCAGATACTTATGCC

TGCTGGAATCATTCTGTGGGTTTTGACTATGTCTATAACCCATTTATGATTGATGTTCAGCAGTGGGGCTTTACGGGTA

ACCTTCAGAGTAACCATGACCAACATTGCCAGGTACATGGAAATGCACATGTGGCTAGTTGTGATGCTATCATGACTAG

ATGTTTAGCAGTCCATGAGTGCTTTGTTAAGCGCGTTGATTGGTCTGTTGAATACCCTATTATAGGAGATGAACTGAGG

GTTAATTCTGCTTGCAGAAAAGTACAACACATGGTTGTGAAGTCTGCATTGCTTGCTGATAAGTTTCCAGTTCTTCATG

ACATTGGAAATCCAAAGGCTATCAAGTGTGTGCCTCAGGCTGAAGTAGAATGGAAGTTCTACGATGCTCAGCCATGTAG

TGACAAAGCTTACAAAATAGAGGAACTCTTCTATTCTTATGCTACACATCACGATAAATTCACTGATGGTGTTTGTTTG

TTTTGGAATTGTAACGTTGATCGTTACCCAGCCAATGCAATTGTGTGTAGGTTTGACACAAGAGTCTTGTCAAACTTGA

ACTTACCAGGCTGTGATGGTGGTAGTTTGTATGTGAATAAGCATGCATTCCACACTCCAGCTTTCGATAAAAGTGCATT

TACTAATTTAAAGCAATTGCCTTTCTTTTACTATTCTGATAGTCCTTGTGAGTCTCATGGCAAACAAGTAGTGTCGGAT

ATTGATTATGTTCCACTCAAATCTGCTACGTGTATTACACGATGCAATTTAGGTGGTGCTGTTTGCAGACACCATGCAA

ATGAGTACCGACAGTACTTGGATGCATATAATATGATGATTTCTGCTGGATTTAGCCTATGGATTTACAAACAATTTGA

TACTTATAACCTGTGGAATACATTTACCAGGTTACAGAGTTTAGAAAATGTGGCTTATAATGTTGTTAATAAAGGACAC

TTTGATGGACACGCCGGCGAAGCACCTGTTTCCATCATTAATAATGCTGTTTACACAAAGGTAGATGGTATTGATGTGG

AGATCTTTGAAAATAAGACAACACTTCCTGTTAATGTTGCATTTGAGCTTTGGGCTAAGCGTAACATTAAACCAGTGCC

AGAGATTAAGATACTCAATAATTTGGGTGTTGATATCGCTGCTAATACTGTAATCTGGGACTACAAAAGAGAAGCCCCA

GCACATGTATCTACAATAGGTGTCTGCACAATGACTGACATTGCCAAGAAACCTACTGAGAGTGCTTGTTCTTCACTTA

CTGTCTTGTTTGATGGTAGAGTGGAAGGACAGGTAGACCTTTTTAGAAACGCCCGTAATGGTGTTTTAATAACAGAAGG

TTCAGTCAAAGGTCTAACACCTTCAAAGGGACCAGCACAAGCTAGCGTCAATGGAGTCACATTAATTGGAGAATCAGTA

AAAACACAGTTTAACTACTTTAAGAAAGTAGACGGCATTATTCAACAGTTGCCTGAAACCTACTTTACTCAGAGCAGAG

ACTTAGAGGATTTTAAGCCCAGATCACAAATGGAAACTGACTTTCTCGAGCTCGCTATGGATGAATTCATACAGCGATA

TAAGCTCGAGGGCTATGCCTTCGAACACATCGTTTATGGAGATTTCAGTCATGGACAACTTGGCGGTCTTCATTTAATG

ATAGGCTTAGCCAAGCGCTCACAAGATTCACCACTTAAATTAGAGGATTTTATCCCTATGGACAGCACAGTGAAAAATT

ACTTCATAACAGATGCGCAAACAGGTTCATCAAAATGTGTGTGTTCTGTGATTGATCTTTTACTTGATGACTTTGTCGA

GATAATAAAGTCACAAGATTTGTCAGTGATTTCAAAAGTGGTCAAGGTTACAATTGACTATGCTGAAATTTCATTCATG

CTTTGGTGTAAGGATGGACATGTTGAAACCTTCTACCCAAAACTACAAGCAAGTCAAGCGTGGCAACCAGGTGTTGCGA

TGCCTAACTTGTACAAGATGCAAAGAATGCTTCTTGAAAAGTGTGACCTTCAGAATTATGGTGAAAATGCTGTTATACC

AAAAGGAATAATGATGAATGTCGCAAAGTATACTCAACTGTGTCAATACTTAAATACACTTACTTTAGCTGTACCCTAC

AACATGAGAGTTATTCACTTTGGTGCTGGCTCTGATAAAGGAGTTGCACCAGGTACAGCTGTGCTCAGACAATGGTTGC

CAACTGGCACACTACTTGTCGATTCAGATCTTAATGACTTCGTCTCCGACGCAGATTCTACTTTAATTGGAGACTGTGC

AACAGTACATACGGCTAATAAATGGGACCTTATTATTAGCGATATGTATGACCCTAGGACCAAACATGTGACAAAAGAG

AATGACTCTAAAGAAGGGTTTTTCACTTATCTGTGTGGATTTATAAAGCAAAAACTAGCCCTGGGTGGTTCTATAGCTG

TAAAGATAACAGAGCATTCTTGGAATGCTGACCTTTACAAGCTTATGGGCCATTTCTCATGGTGGACAGCTTTTGTTAC

AAATGTAAATGCATCATCATCGGAAGCATTTTTAATTGGGGCTAACTATCTTGGCAAGCCGAAGGAACAAATTGATGGC

TATACCATGCATGCTAACTACATTTTCTGGAGGAACACAAATCCTATCCAGTTGTCTTCCTATTCACTCTTTGACATGA

GCAAATTTCCTCTTAAATTAAGAGGAACTGCTGTAATGTCTCTTAAGGAGAATCAAATCAATGATATGATTTATTCTCT

TCTGGAAAAAGGTAGGCTTATCATTAGAGAAAACAACAGAGTTGTGGTTTCAAGTGATATTCTTGTTAACAACTAAACG

AACATGTTTATTTTCTTATTATTTCTTACTCTCACTAGTGGTAGTGACCTTGACCGGTGCACCACTTTTGATGATGTTC

AAGCTCCTAATTACACTCAACATACTTCATCTATGAGGGGGGTTTACTATCCTGATGAAATTTTTAGATCAGACACTCT

TTATTTAACTCAGGATTTATTTCTTCCATTTTATTCTAATGTTACAGGGTTTCATACTATTAATCATACGTTTGGCAAC

CCTGTCATACCTTTTAAGGATGGTATTTATTTTGCTGCCACAGAGAAATCAAATGTTGTCCGTGGTTGGGTTTTTGGTT

CTACCATGAACAACAAGTCACAGTCGGTGATTATTATTAACAATTCTACTAATGTTGTTATACGAGCATGTAACTTTGA

ATTGTGTGACAACCCTTTCTTTGCTGTTTCTAAACCCATGGGTACACAGACACATACTATGATATTCGATAATGCATTT

AATTGCACTTTCGAGTACATATCTGATGCCTTTTCGCTTGATGTTTCAGAAAAGTCAGGTAATTTTAAACACTTACGAG

AGTTTGTGTTTAAAAATAAAGATGGGTTTCTCTATGTTTATAAGGGCTATCAACCTATAGATGTAGTTCGTGATCTACC

TTCTGGTTTTAACACTTTGAAACCTATTTTTAAGTTGCCTCTTGGTATTAACATTACAAATTTTAGAGCCATTCTTACA

GCCTTTTCACCTGCTCAAGACATTTGGGGCACGTCAGCTGCAGCCTATTTTGTTGGCTATTTAAAGCCAACTACATTTA

TGCTCAAGTATGATGAAAATGGTACAATCACAGATGCTGTTGATTGTTCTCAAAATCCACTTGCTGAACTCAAATGCTC

TGTTAAGAGCTTTGAGATTGACAAAGGAATTTACCAGACCTCTAATTTCAGGGTTGTTCCCTCAGGAGATGTTGTGAGA

TTCCCTAATATTACAAACTTGTGTCCTTTTGGAGAGGTTTTTAATGCTACTAAATTCCCTTCTGTCTATGCATGGGAGA

GAAAAAAAATTTCTAATTGTGTTGCTGATTACTCTGTGCTCTACAACTCAACATTTTTTTCAACCTTTAAGTGCTATGG

CGTTTCTGCCACTAAGTTGAATGATCTTTGCTTCTCCAATGTCTATGCAGATTCTTTTGTAGTCAAGGGAGATGATGTA

AGACAAATAGCGCCAGGACAAACTGGTGTTATTGCTGATTATAATTATAAATTGCCAGATGATTTCATGGGTTGTGTCC

TTGCTTGGAATACTAGGAACATTGATGCTACTTCAACTGGTAATTATAATTATAAATATAGGTATCTTAGACATGGCAA

GCTTAGGCCCTTTGAGAGAGACATATCTAATGTGCCTTTCTCCCCTGATGGCAAACCTTGCACCCCACCTGCTCTTAAT

TGTTATTGGCCATTAAATGATTATGGTTTTTACACCACTACTGGCATTGGCTACCAACCTTACAGAGTTGTAGTACTTT

CTTTTGAACTTTTAAATGCACCGGCCACGGTTTGTGGACCAAAATTATCCACTGACCTTATTAAGAACCAGTGTGTCAA

TTTTAATTTTAATGGACTCACTGGTACTGGTGTGTTAACTCCTTCTTCAAAGAGATTTCAACCATTTCAACAATTTGGC

CGTGATGTTTCTGATTTCACTGATTCCGTTCGAGATCCTAAAACATCTGAAATATTAGACATTTCACCTTGCGCTTTTG

GGGGTGTAAGTGTAATTACACCTGGAACAAATGCTTCATCTGAAGTTGCTGTTCTATATCAAGATGTTAACTGCACTGA

TGTTTCTACAGCAATTCATGCAGATCAACTCACACCAGCTTGGCGCATATATTCTACTGGAAACAATGTATTCCAGACT

CAAGCAGGCTGTCTTATAGGAGCTGAGCATGTCGACACTTCTTATGAGTGCGACATTCCTATTGGAGCTGGCATTTGTG

CTAGTTACCATACAGTTTCTTTATTACGTAGTACTAGCCAAAAATCTATTGTGGCTTATACTATGTCTTTAGGTGCTGA

TAGTTCAATTGCTTACTCTAATAACACCATTGCTATACCTACTAACTTTTCAATTAGCATTACTACAGAAGTAATGCCT

GTTTCTATGGCTAAAACCTCCGTAGATTGTAATATGTACATCTGCGGAGATTCTACTGAATGTGCTAATTTGCTTCTCC

AATATGGTAGCTTTTGCACACAACTAAATCGTGCACTCTCAGGTATTGCTGCTGAACAGGATCGCAACACACGTGAAGT

GTTCGCTCAAGTCAAACAAATGTACAAAACCCCAACTTTGAAATATTTTGGTGGTTTTAATTTTTCACAAATATTACCT

GACCCTCTAAAGCCAACTAAGAGGTCTTTTATTGAGGACTTGCTCTTTAATAAGGTGACACTCGCTGATGCTGGCTTCA

TGAAGCAATATGGCGAATGCCTAGGTGATATTAATGCTAGAGATCTCATTTGTGCGCAGAAGTTCAATGGACTTACAGT

GTTGCCACCTCTGCTCACTGATGATATGATTGCTGCCTACACTGCTGCTCTAGTTAGTGGTACTGCCACTGCTGGATGG

ACATTTGGTGCTGGCGCTGCTCTTCAAATACCTTTTGCTATGCAAATGGCATATAGGTTCAATGGCATTGGAGTTACCC

AAAATGTTCTCTATGAGAACCAAAAACAAATCGCCAACCAATTTAACAAGGCGATTAGTCAAATTCAAGAATCACTTAC

AACAACATCAACTGCATTGGGCAAGCTGCAAGACGTTGTTAACCAGAATGCTCAAGCATTAAACACACTTGTTAAACAA

CTTAGCTCTAATTTTGGTGCAATTTCAAGTGTGCTAAATGATATCCTTTCGCGACTTGATAAAGTCGAGGCGGAGGTAC

AAATTGACAGGTTAATTACAGGCAGACTTCAAAGCCTTCAAACCTATGTAACACAACAACTAATCAGGGCTGCTGAAAT

CAGGGCTTCTGCTAATCTTGCTGCTACTAAAATGTCTGAGTGTGTTCTTGGACAATCAAAAAGAGTTGACTTTTGTGGA

AAGGGCTACCACCTTATGTCCTTCCCACAAGCAGCCCCGCATGGTGTTGTCTTCCTACATGTCACGTATGTGCCATCCC

AGGAGAGGAACTTCACCACAGCGCCAGCAATTTGTCATGAAGGCAAAGCATACTTCCCTCGTGAAGGTGTTTTTGTGTT

TAATGGCACTTCTTGGTTTATTACACAGAGGAACTTCTTTTCTCCACAAATAATTACTACAGACAATACATTTGTCTCA

GGAAATTGTGATGTCGTTATTGGCATCATTAACAACACAGTTTATGATCCTCTGCAACCTGAGCTTGACTCATTCAAAG

AAGAGCTGGACAAGTACTTCAAAAATCATACATCACCAGATGTTGATCTTGGCGACATTTCAGGCATTAACGCTTCTGT

CGTCAACATTCAAAAAGAAATTGACCGCCTCAATGAGGTCGCTAAAAATTTAAATGAATCACTCATTGACCTTCAAGAA

TTGGGAAAATATGAGCAATATATTAAATGGCCTTGGTATGTTTGGCTCGGCTTCATTGCTGGACTAATTGCCATCGTCA

TGGTTACAATCTTGCTTTGTTGCATGACTAGTTGTTGCAGTTGCCTCAAGGGTGCATGCTCTTGTGGTTCTTGCTGCAA

GTTTGATGAGGATGACTCTGAGCCAGTTCTCAAGGGTGTCAAATTACATTACACATAAACGAACTTATGGATTTGTTTA

TGAGATTTTTTACTCTTAGATCAATTACTGCACAGCCAGTAAAAATTGACAATGCTTCTCCTGCAAGTACTGTTCATGC

TACAGCAACGATACCGCTACAAGCCTCACTCCCTTTCGGATGGCTTGTTATTGGCGTTGCATTTCTTGCTGTTTTTCAG

AGCGCTACCAAAATAATTGCGCTCAATAAAAGATGGCAGCTAGCCCTTTATAAGGGCTTCCAGTTCATTTGCAATTTAC

TGCTGCTATTTGTTACCATCTATTCACATCTTTTGCTTGTCGCTGCAGGTATGGAGGCGCAATTTTTGTACCTCTATGC

CTTGATATATTTTCTACAATGCATCAACGCATGTAGAATTATTATGAGATGTTGGCTTTGTTGGAAGTGCAAATCCAAG

AACCCATTACTTTATGATGCCAACTACTTTGTTTGCTGGCACACACATAACTATGACTACTGTATACCATATAACAGTG

TCACAGATACAATTGTCGTTACTGAAGGTGACGGCATTTCAACACCAAAACTCAAAGAAGACTACCAAATTGGTGGTTA

TTCTGAGGATAGGCACTCAGGTGTTAAAGACTATGTCGTTGTACATGGCTATTTCACCGAAGTTTACTACCAGCTTGAG

TCTACACAAATTACTACAGACACTGGTATTGAAAATGCTACATTCTTCATCTTTAACAAGCTTGTTAAAGACCCACCGA

ATGTGCAAATACACACAATCGACGGCTCTTCAGGAGTTGCTAATCCAGCAATGGATCCAATTTATGATGAGCCGACGAC

GACTACTAGCGTGCCTTTGTAAGCACAAGAAAGTGAGTACGAACTTATGTACTCATTCGTTTCGGAAGAAACAGGTACG

TTAATAGTTAATAGCGTACTTCTTTTTCTTGCTTTCGTGGTATTCTTGCTAGTCACACTAGCCATCCTTACTGCGCTTC

GATTGTGTGCGTACTGCTGCAATATTGTTAACGTGAGTTTAGTAAAACCAACGGTTTACGTCTACTCGCGTGTTAAAAA

TCTGAACTCTTCTGAAGGAGTTCCTGATCTTCTGGTCTAAACGAACTAACTATTATTATTATTCTGTTTGGAACTTTAA

CATTGCTTATCATGGCAGACAACGGTACTATTACCGTTGAGGAGCTTAAACAACTCCTGGAACAATGGAACCTAGTAAT

AGGTTTCCTATTCCTAGCCTGGATTATGTTACTACAATTTGCCTATTCTAATCGGAACAGGTTTTTGTACATAATAAAG

CTTGTTTTCCTCTGGCTCTTGTGGCCAGTAACACTTGCTTGTTTTGTGCTTGCTGCTGTCTACAGAATTAATTGGGTGA

CTGGCGGGATTGCGATTGCAATGGCTTGTATTGTAGGCTTGATGTGGCTTAGCTACTTCGTTGCTTCCTTCAGGCTGTT

TGCTCGTACCCGCTCAATGTGGTCATTCAACCCAGAAACAAACATTCTTCTCAATGTGCCTCTCCGGGGGACAATTGTG

ACCAGACCGCTCATGGAAAGTGAACTTGTCATTGGTGCTGTGATCATTCGTGGTCACTTGCGAATGGCCGGACACTCCC

TAGGGCGCTGTGACATTAAGGACCTGCCAAAAGAGATCACTGTGGCTACATCACGAACGCTTTCTTATTACAAATTAGG

AGCGTCGCAGCGTGTAGGCACTGATTCAGGTTTTGCTGCATACAACCGCTACCGTATTGGAAACTATAAATTAAATACA

GACCACGCCGGTAGCAACGACAATATTGCTTTGCTAGTACAGTAAGTGACAACAGATGTTTCATCTTGTTGACTTCCAG

GTTACAATAGCAGAGATATTGATTATCATTATGAGGACTTTCAGGATTGCTATTTGGAATCTTGACGTTATAATAAGTT

CAATAGTGAGACAATTATTTAAGCCTCTAACTAAGAAGAATTATTCGGAGTTAGATGATGAAGAACCTATGGAGTTAGA

TTATCCATAAAACGAACATGAAAATTATTCTCTTCCTGACATTGATTGTATTTACATCTTGCGAGCTATATCACTATCA

GGAGTGTGTTAGAGGTACGACTGTACTACTAAAAGAACCTTGCCCATCAGGAACATACGAGGGCAATTCACCATTTCAC

CCTCTTGCTGACAATAAATTTGCACTAACTTGCACTAGCACACACTTTGCTTTTGCTTGTGCTGACGGTACTCGACATA

CCTATCAGCTGCGTGCAAGATCAGTTTCACCAAAACTTTTCATCAGACAAGAGGAGGTTCAACAAGAGCTCTACTCGCC

ACTTTTTCTCATTGTTGCTGCTCTAGTATTTTTAATACTTTGCTTCACCATTAAGAGAAAGACAGAATGAATGAGCTCA

CTTTAATTGACTTCTATTTGTGCTTTTTAGCCTTTCTGCTATTCCTTGTTTTAATAATGCTTATTATATTTTGGTTTTC

ACTCGAAATCCAGGATCTAGAAGAACCTTGTACCAAAGTCTAAACGAACATGAAACTTCTCATTGTTTTGACTTGTATT

TCTCTATGCAGTTGCATATGCACTGTAGTACAGCGCTGTGCATCTAATAAACCTCATGTGCTTGAAGATCCTTGTAAGG

TACAACACTAGGGGTAATACTTATAGCACTGCTTGGCTTTGTGCTCTAGGAAAGGTTTTACCTTTTCATAGATGGCACA

CTATGGTTCAAACATGCACACCTAATGTTACTATCAACTGTCAAGATCCAGCTGGTGGTGCGCTTATAGCTAGGTGTTG

GTACCTTCATGAAGGTCACCAAACTGCTGCATTTAGAGACGTACTTGTTGTTTTAAATAAACGAACAAATTAAAATGTC

TGATAATGGACCCCAATCAAACCAACGTAGTGCCCCCCGCATTACATTTGGTGGACCCACAGATTCAACTGACAATAAC

CAGAATGGAGGACGCAATGGGGCAAGGCCAAAACAGCGCCGACCCCAAGGTTTACCCAATAATACTGCGTCTTGGTTCA

CAGCTCTCACTCAGCATGGCAAGGAGGAACTTAGATTCCCTCGAGGCCAGGGCGTTCCAATCAACACCAATAGTGGTCC

AGATGACCAAATTGGCTACTACCGAAGAGCTACCCGACGAGTTCGTGGTGGTGACGGCAAAATGAAAGAGCTCAGCCCC

AGATGGTACTTCTATTACCTAGGAACTGGCCCAGAAGCTTCACTTCCCTACGGCGCTAACAAAGAAGGCATCGTATGGG

TTGCAACTGAGGGAGCCTTGAATACACCCAAAGACCACATTGGCACCCGCAATCCTAATAACAATGCTGCCACCGTGCT

ACAACTTCCTCAAGGAACAACATTGCCAAAAGGCTTCTACGCAGAGGGAAGCAGAGGCGGCAGTCAAGCCTCTTCTCGC

TCCTCATCACGTAGTCGCGGTAATTCAAGAAATTCAACTCCTGGCAGCAGTAGGGGAAATTCTCCTGCTCGAATGGCTA

GCGGAGGTGGTGAAACTGCCCTCGCGCTATTGCTGCTAGACAGATTGAACCAGCTTGAGAGCAAAGTTTCTGGTAAAGG

CCAACAACAACAAGGCCAAACTGTCACTAAGAAATCTGCTGCTGAGGCATCTAAAAAGCCTCGCCAAAAACGTACTGCC

ACAAAACAGTACAACGTCACTCAAGCATTTGGGAGACGTGGTCCAGAACAAACCCAAGGAAATTTCGGGGACCAAGACC

TAATCAGACAAGGAACTGATTACAAACATTGGCCGCAAATTGCACAATTTGCTCCAAGTGCCTCTGCATTCTTTGGAAT

GTCACGCATTGGCATGGAAGTCACACCTTCGGGAACATGGCTGACTTATCATGGAGCCATTAAATTGGATGACAAAGAT

CCACAATTCAAAGACAACGTCATACTGCTGAACAAGCACATTGACGCATACAAAACATTCCCACCAACAGAGCCTAAAA

AGGACAAAAAGAAAAAGACTGATGAAGCTCAGCCTTTGCCGCAGAGACAAAAGAAGCAGCCCACTGTGACTCTTCTTCC

TGCGGCTGACATGGATGATTTCTCCAGACAACTTCAAAATTCCATGAGTGGAGCTTCTGCTGATTCAACTCAGGCATAA

ACACTCATGATGACCACACAAGGCAGATGGGCTATGTAAACGTTTTCGCAATTCCGTTTACGATACATAGTCTACTCTT

GTGCAGAATGAATTCTCGTAACTAAACAGCACAAGTAGGTTTAGTTAACTTTAATCTCACATAGCAATCTTTAATCAAT

GTGTAACATTAGGGAGGACTTGAAAGAGCCACCACATTTTCATCGAGGCCACGCGGAGTACGATCGAGGGTACAGTGAA

TAATGCTAGGGAGAGCTGCCTATATGGAAGAGCCCTAATGTGTAAAATTAATTTTAGTAGTGCTATCCCCATGTGATTT

TAATAGCTTCTTAGGAGAATGACAAAAAAAAAAAAAAAAAAAAAAAA

Surreal Grime
"Hello Nights...Hello Days"....spotted back of white truck Southbound M23 J8>J9. Love to think this was a piece of deep meaningful thought, but probably just a greeting to the cab monkey on Night shift to the cab monkey on the day shift. Two sets of handwriting seemed to confirm this. Did notice that the "Hello Nights" include the letter "i", where the 'dot' was written as a circle. Never study handwriting analysis....

Little Defeat
Can of Diet Pepsi, 45p. Insert 50p, no change give. Net loss 5p.

Little Victory
One Twix, 35p. 40p entered into vending machine, 10p returned...net profit 5p.


A Bemuddlement Fan Provided.....
Bold Panning CD:Ounce of Courage
Aerial Phew CD:Dead Overhead
Gammas Anagram Granma CD:Countdown
Spilt! CD:Mopped.
Boretex CD:Impervious Precipitations

Little Victory
Pack of five A5 notebooks, recommended proce 7.99UKP, actual cost 1.60UKP. Net profit 6.36UKP.

Life in the Slow Lane
Scenic drive down M23 J8 to J10. Cause..unknown..although Police car spotted on hard shoulder giving BMW a hard time. Delay = 3 songs on WUTW.

Petty Crime
OK so 'Free Falling' is a great track, but it's been played three times on three separate radio stations in the last hour and fourty five minutes. Radio 2 at 7:50pm, Virgin at 9:10pm and now on Planet Rock. Is this a record?

Top Tip
M25 traffic police, don't close the motorway, simply fold down the central reservation allowing motorists to turn around and approach their destination from the other direction. The 3 hour detour, would be far preferable to the 5 hour closure I experienced last week.

Great Names for Rock Bands Part 1
"The Amazing Kargol (and Janet)"
"Lemming of the BDA

Life in the Slow Lane

Hang on...this is Friday, so why the crawl around the M25 Kent and Surrey sections today....ah of course...it was raining. Journey time.....1.47 plays of The White Stripes- Elephant
Jack and Meg, provided the musical stopwatch for todays Motorway grind.

Happy Birthday Henry McGee.....

Happy Birthday to Henry McGee. A personal Bemuddlement Hero
	Hail Henry. bemuddlement Hero and all round good guy

Personalised Number Plates
"13" does not look like a "B".
"4" does not look like an "A"
"5" does not look like an "S"
"7" does not look like a "T"
"P" with a strategically placed rivit does look like an "A"
"12" does not look like an "R"
"0" does not look like a "D"

13457P.120......see!!!!!!

Little Victory
2p left in change well in coffee machine. 18p Campachino...net cost 16p.

Life in the Slow Lane
Great thanks to the Surrey Police who decided that it would be far better to close 3 out of 4 Lanes of the Clock-wise M25 between J8/J9 on Wednesday morning, than keep the flow of traffic moving. Net delay 4.5 hours, still it did mean I didn't turn up for pointless meeting until lunchtime.
Even Greater decision is to prevent access to the A303 eastbound off the A350 at the moment...well done..Wiltshire and Somerset County Councils, especially for hiding the diversion and warning signs at the roundabout intersection with the A36. Still at least managed to listen to the whole of the Ronnie O'Sullivan Interview on Steve Wright show.
Fantastic smoke display as truck caught fire M25 anti-clock between J10/J9.....excellent distraction

Check Out....
The Guitar players gallery on the BBC2 website

Confused Defeat
Wanted: One can of Britvic Orange Juice from Vending Machine price 60p
Got : One can of "Red Devil" energy drink...poor man's Red Bull prive 1UKP!!!!

Happiness is...
Entire Led Zeppelin back catalogue, MP3'd, on laptop HD :-)..

"Don't be sad... 7 out of 8 ain't bad"
"So!" I said, "Council Elections" I said
"Yes", she said, "Parish council too", she said, "two crosses on the white", "upto seven on the green" she said
"7 on the Green?" I said
"yes", she said
"but there are only 8 names on the green", I said
"yes" she said
"I'd hate to be the one that loses this one" I said
"Yes" she said

Zoom GFX-707-II
OK, so it maybe only 3 weeks since I got the 606, but having tried this out there was no way I could go without.

Fav Patch: GaryBD (Parisian Walkways here we come) Best Sample Loop Recorded: A rather nice "Bring on the Night" Smart Media: Essential (64MB) Does it do the Jimmy Page "For Your Life" Trem Drop?: Yes :-)) Drum Machine: Fun...all of a sudden three power chords sound good on your own. Neatest Feature(s): Master Volume control knob.  Romy and Lilo's reaction: Wunderschone!
	A lot of bang for the buck. Zoom 707-II...yesterday

Doing Business with the French Course
....major conclusion..don't...

Current Spins
Fleetwood Mac - Say You Will ****1/2.
The Macs, minus Christine McVie. Lindsey going ape with the new technology in the studio. Incredible.Standout Tracks: "Miranda", "Come", "Goodbye Baby"

Peter Gabriel - So (re mastered) *****
The The - Infected *****
The The - Soul Mining ***1/2

Current Fav
DAB Station : Planet Rock
Sky Digi Station : KERRANG!
Drink : Fetzer Californian Merlot
TV Prog : You kidding, "There's nothing on the telly"
Best Recent Achievement : 58 at Snodhurst Bottom Pitch n Putt

Recovering Vegetarian
Breaded Haddock for lunch. Quite exceptional.

Doing Business with the French Course
Discovered that, unfortunately, slitting their throats isn't an option. Did come to the conclusion that France is wasted on the French however. Confirmed by 5 independent sources today.

Grime Increase
Some rather fine examples spotted today
"HONK IF YOU ARE GAY" (we didn't...not that there is anything wrong with that)
"OLD MAN" (spotted back of white transit lorry)

Recovering Vegetarian
Hmmmm. Angus beef Steak Burgers........Chicken Madras awaits

Life in the Slow Lane   What is wrong with the motorway network in this country? OK so its Monday School Easter Holidays are Over It's Raining A truck had rolled over on the M25 blocking two Lanes Clockwise and causing delays back to J4 and 3 mile tailback on the M26  A car collided with a motorcyclist just before J7 (Clockwise) closing another two lanes At least Terry Wogan was stuck in a similar jam on the other side of London

Seems the whole world was stuck in a traffic jam this morning including Togemeister Wogan.

Life In the Fast Lane Splendid journey only last 1.1 Plays of the Foo Fighters Debut Album. Grime Grime today had a footballing theme. there was one very artistic reworking of "Clean Me" which was transformed into a scruffy "Chelsea". Large Red removal lorry (south bound M23) displayed "COV CITY FC".
	David Grohls's Foo's Debeut providing today's journet timing.

Grime Report Grime Graffiti is back. A splendid face of a pig on the back of a loft installation van, West bound M20. Life in the Slow Lane Must be Pheasant season...3 perfect road kill specimens in the central reservation of the M26. Slightly foggy this morning. Time delay: Two rather breathy plays of Peter Gabriel and Kate Bush's - Don't Give up.
	Hideously deformed and incredibly ugly woman, Kate Bush, provided a Breathy Delay timing today.

Jaguar 2.5 Owners
If you are going to pretend your driving a Rover 75, save 20UKP and get the rectangular number plate for the rear of your vehicle

Rover 75 Owners
If you are going to pretend that your driving a Jaguar, then please spend the extra 20UKP and get the appropriately shaped rear number plate, instead of the standard rectangular one.

IT'S BACK (sorta)
Well they call it 'Rebel Yell', but hey Virgin Radio is back playing decent music on Saturday nights again...

Deck of Cards

"When I see the Eight, I am not reminded of the number of Apache Helicopters firing Missiles at my hideout...there are no Apache helicopters here and I am not hiding..nor should you" - Mohammed Saeed Al-Shahaf, Iraqi Minister of Information, curiously missing from the  The DoD Iraqi "Deck of Cards"
	8 of Spades Tariq Aziz...not yesterday

Little Victory
2p left in Coffee Machine for yummy campachino. Net profit 2p.

Same Voice?
Sir Richard Branson, whispering Bob Harris and Tony Blair?

Al Jazeera Television
Is Arabic read from left to Right or Right to Left? When Al Jazeera clips are broadcast on Western television News stations, the scrolling ticker goes both left-to-right and right-to-left and it speeds up and slows down.

Little Defeat
Vending machine failed to dispense packet of Polo Mints. Net Loss 22p.

Life In the Slow Lane
Must be summer, two Kosovo refugees spotted on the Kentish sections of the M20 and it's tributaries

Little Victory
Inserted 20p for frothy campachino, noticed 2p left in machine, pressed the change button expected 4p change, received 24p in return. Net profit 1 cup of campachino + 4p.

Oh for $26,0000

It could've been mine. I missed the third auction. All three of his Jesters have now been sold at auction and are in private collectors hands

Life In The Slow Lane
Top Tip: If any juggernaut drivers ever do read this blog, may I recommend that you always take the first exit slip lane onto the M26 and not the second one, like the Italian driver did this morning, who could then barely get past the Dutch lorry on the inside lane travelling at 0.25mph slower.

Reduction in Grime Figures
No grime graffiti to report to day, but I did learn that AMOY Soya Sauce is used in 9 out 10 Chinese restaurants. A worrying advertising slogan, seeing as 8 out 10 owners said, their cats avoid Chinese restaurants like the proverbial plague.

Accept no Substitutes
The 24-bit remastered CD series of Blondie's back catelogue is essential. My original copy of "Parallel Lines" will soon hit coffee mat status.

Looting in Baghdad
Anyone remember that scene in "The Rutles" when the offices of "Rutle Corp" were looted?

Polymer Poisoning
Well it seems that there are no ill effects from the plastic tasting campachino ingested yesterday. This is fortunate, as I've just realised it's Friday. Nothing worse than having food poisoning in your own time.

Current Spins
White Stripes - Elephant ****1/2
The The - Infected *****
Placebo- Sleeping with Ghosts **** (finally a Plecebo album that sounds different)
Blondie - Plastic Letters ***** [the one every forgets...DH never sounded better than on "Fan Mail"]
Eminem - Marshall Mathers **** (I gave in...he's good)
Marc Almond & Foetus Slut - Flesh Volcano (** for the album but ****** for the name)

Current DAB Station: Planet Rock.....as always
Fave Sky Digi Station: VH1 Classics
Purchase of the Week: Zoom 606
Highlight of the Week: Discovering that the Zoom 606 has a patch that mimics Jimmy's sound on "For Your Life" (complete with pitch shift).

"You Foreign Criminals..."

May Mohammed Saeed al-Sahaf get his own cable television chat show. This site is awesome.

"Never Thought I'd See They Day"
Rush's "The Spirit of Radio" played during Jonnie Walker's 'cruisin''...............AWESOME!!!!! Radio 2 came alive today.

DAB #3

It maybe the worlds smallest DAB radio (at the moment), but thankfully it includes an FM radio. It seems DAB has problems penetrating this steel, concrete, dungeon that is my place of work.

Strange Day
Snow. Anglo-French Concord.Campachino tasted like plastic....could be good for a few days off. Stay tuned for potential outbreak polymer induced coffee poisoning.

Life in the Slow Lane
Delays M23 Southbound this morning, gawping at the accident North bound between J9/J8. Delay: 4 songs on "Wake Up To Wogan".

Little Victories
7p found in change dispenser whilst buying cup of campachino.

"Sing up Beany"
Are Portsmouth FC really sponsered by Beanie Baby manufacturer TY?

Rare Urban Sight
Pheasant trying to dodge the traffic on Manor Royal Industrial Estate.

Silly Defeat
Selected "own cup" option on frothy cup of campachino, only forgot "own cup". Net loss 18p as liquid poured directly into drip tray.

Petty Grime
A rather uninspiring "Clean Me". White logistics lorry South bound M23

Life in the Slow Lane
Splendid decision made jointly by West Sussex County Council and the Highways Agency to reduce the roundabout at J10 of the M23 down to one lane. This coupled with the fact that said roundabout has traffic lights on it as well, caused a fantastic jam this morning of approximately 5 miles, extending back beyond J9. Another three weeks of motorway agency madness awaits.

Life Imitating Grime
"DIESEL" spotted on the back of a VW Diesel Golf. Also a rather surreal "BUG" on the back of a Royal Mail truck...most odd.

Repeat Grime Offender

A Grime tastic morning today, even saw the same truck with "TRIGGER HAPPY YANKS" scribbled on it. I am never failed to be amazed at the quality of inscriptions seen on the back of white vans. They act as small portals on the intellect of the noble creature that is the "White Van Driver". Two fine examples seen today..

"I wish my wife was as dirty as this"
"My ar*e is cleaner than this van

Great Unsung Led Zeppelin Song Whilst playing the entire Led Zeppelin back catalogue back on MP3 tonight. Isn't "For Your Life" just awesome?. Q Led Zep special out this month...essential. This track didn't even make the top 50 Zep tunes....."Ten Years Gone" made #5 though. This will make Romy, Lilo and one very cool guy in a local guitar shop very very happy. I urge you all to worship at the alter of Jimmy Page..I just had to include this scan from the Q special. Those of us that play...understand that look, that pose, that exhilaration...and we know it's for real...not posed. That's why for me Jimmy will always be the master......

Saturday is Alright for a Grime
A very rare "WASH ME!" spotted on the back of a very grime encrusted VW golf, plus, on the back of a medium sized white removal van "I LOVE SEX". Both spotted on the upper tributaries of the M20.

Grime Plan
A small road map of a housing estate spotted on the back of a white hire transit van. Impressive.

Sex Grime
Spoted on the back of a truck on the Crawley Way approaching J10 of M23, "If my wife was as dirty as this, I'd hire her out". We laughed.

Little Defeats
Coffee machine swallowed my 20p and refused to dispense frothy cup of "campachino". Net loss 20p.

Fellow Blogger
Where is Raed (for those of you who don't know) is the blogger of a Baghdad citizen. Take it at face value, like everything on the Internet.

Political Grime

"TRIGGER HAPPY YANKS" read this informed piece of social comment on the back of a haulage lorry at the M20/M26 westbound interchange this morning.
Tuesdays grime made me laugh, today's incensed me. All I can say is that,
a) I'd rather be on the U.K side than the Iraq side
b) I'd rather live in the U.K than Iraq.


War is unpleasant, never desirable, but sometimes, you just have to kick someone's butt, especially when the only language they understand is violence, torture, aggression, dictatorship and oppression. Diplomacy and Democracy works best when your dealing with democratic States that embrace the diplomatic process, not those that use it as a veil to continue covert, illegal activities that endanger millions of peoples lives.

Finally, I hope for the well-being of ALL involved in this conflict be they coalition or Iraqi. My thoughts are with them, their families and their friends. I hope for swift, peaceful solution soon.

Graffiti Grime
This one actually made me laugh, on the back of a medium sized truck approaching the M20. "WASH ME" was crossed out and replaced with "BURN ME".

Quote of the day...
"You know the world is going crazy when the best rapper is a white guy, the best golfer is a black guy, France is accusing the US of arrogance and Germany doesn't want to go to war."

"One for Sorrow"
Well it was for one magpie, spotted splattered in the French Guttering, on the M26.

"Buddy can you spare be a grime?"
An uninspiring grime day today. "THOMPSON'S" was spotted on the back of a Co-Op delivery van and anther very common "CLEAN ME!" on the back of a small white hatchback van. Both spotted on God's own Car Park, the M25.

Urban Myth Destroyed
GPS accuracy report : 6m

Du Sprechts Zwiebel, Ich Spreche Swiebel
It could be that the German grime graffiti spotted below, may not have been "Zwiebel", the German word for Onion, but "Swiebel" the surname of Dutch MEP Joke Swiebel

Sky News Nearly Fooled
Well I was almost convinced that Gulf War 2: "This Time It's Personal" was going to kick off last night as Sky News dragged Kay "I've broke every major news story for the last 12 years" Burley out of bed for the midnight to 3am slot. It was looking dodgy, but luckily it kicked off at 2:30am and face was saved.

"Springgrime for Hitler"
Good to see our Teutonic cousins getting in on the act, "Markus + Arija = Sex" spotted on the side of a German juggernaut on the M25 approaching J6 on the clockwise carriageway this morning.
Also spotted was "ZWEIBEL", but why anyone would scribe the German word for Onion on the side of a truck escapes me (unless it was carrying onions of course).
We know that "CLEAN ME" is a very common grime graffiti spot, but this was seen on the back of a Black Fiesta on the M23 approaching J9, a rare combination.
And Finally a beautiful picture of a dog very reminiscent of a Lascaux cave painting, driven by a man very reminiscent of a Lascaux caveman.


Life In The Slow Lane
Most Spectacular Sight: 4x4 car fire on the M23
Nostalgia Motor Moment: A rather fine 1973 Wolseley Six

Wildlife Tip
Look out for squirrels laying dead and perfectly formed in tree-lined avenues. These are the ones that miss the branch and plummet to their deaths onto the tar macadam. Two already spotted in one week. Gene-pool elimination is a wonderful thing.

Little Defeats
Vending machine failed to dispense packet of Walkers Beef and Onion flavoured crisps(suitable for vegetarians, 181 calories). Net loss 28p.

Grime and Misdemeanours
The back of the beer delivery lorry, spotted on the M20, had the words "John Smith's EXTRA SMOOTH" almost obliterated by grime. Creative credit must be given to the person who then uncovered the "TH" in "SMOOTH" and added "FC", to spell out the abbreviation for the club who reside at Three-point Lane (as us Chelsea supporters have come to know it.
Oh there was one "Clean Me!" spotted as well.

"I Don't like Spam"
Why would I be interested in a video featuring a mass horde of aggressive, nasty, young people, suffering from premature hair loss? I presume that's what "10,000 Bald Teen C*nts" refers to?

Not-so-obscure Pop/Rock Music Trivia Fact #2
Jimi Hendrix, although left-handed, primarily played a right-handed Fender Stratocaster, but strung correctly for a left-handed player.

Grime Up North
"Beware Dog In Back" and to the left on the back of the same van a drawn game of noughts and crosses. Above the drawn match the words "It Doesn't Look Good"....it didn't.

Shock of the Day
Penny Smith is 45 ??????????

Little Victories
5p left in coffee machine. Cappuccino 13p instead of 18p.

Not-so-obscure Pop/Rock Music Trivia Fact #1
When Dexy's Midnight Runners performed "Jackie Wilson Said" on Top of the Pops, it was performed in front of a screen bearing an image of Scottish Darts supremo, Jockie Wilson. Intentional/unintentional? We shall never know.


"..it's written in the Grime"
Well what started off as a potential refugee sighting (a common sight walking the hard shoulders of the Kentish motorway system) actually turned out to be driver of this mornings grime graffiti "Free Celtic Spirit". Ironic that it was scrawled on the back of a broken down Anglican Windows van.